From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS06505 [old locus tag: NWMN_1153 ]
  • pan locus tag?: SAUPAN003535000
  • symbol: NWMN_RS06505
  • pan gene symbol?: rbgA
  • synonym:
  • product: ribosome biogenesis GTPase YlqF

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS06505 [old locus tag: NWMN_1153 ]
  • symbol: NWMN_RS06505
  • product: ribosome biogenesis GTPase YlqF
  • replicon: chromosome
  • strand: +
  • coordinates: 1265099..1265983
  • length: 885
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (1265099..1265983) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGGTTATTCAATGGTATCCAGGACATATGGCGAAAGCCAAAAGAGAAGTAAGTGAACAA
    TTAAAAAAAGTAGATGTAGTGTTTGAACTAGTAGATGCAAGAATTCCATATAGTTCAAGA
    AACCCTATGATAGATGAAGTTATTAACCAAAAACCACGTGTTGTTATATTAAATAAAAAA
    GATATGTCTAATTTAAATGAGATGTCAAAATGGGAACAATTTTTTATTGATAAAGGATAC
    TATCCTGTATCAGTGGATGCTAAGCACGGTAAAAATTTAAAGAAAGTGGAAGCTGCAGCA
    ATTAAGGCGACTGCTGAAAAATTTGAACGCGAAAAAGCGAAAGGACTTAAACCTAGAGCG
    ATAAGAGCAATGATCGTTGGAATTCCAAATGTTGGTAAATCCACATTAATAAATAAACTG
    GCAAAGCGTAGTATTGCGCAGACTGGTAATAAACCAGGTGTGACCAAACAACAACAATGG
    ATTAAAGTTGGTAATGCATTACAACTATTAGACACACCAGGGATACTTTGGCCTAAATTT
    GAAGATGAAGAAGTCGGTAAGAAGTTGAGTTTAACTGGTGCGATAAAAGATAGTATTGTG
    CACTTAGATGAAGTTGCCATCTATGGATTAAACTTTTTAATTCAAAATGATTTAGCGCGA
    TTAAAGTCACATTATAATATTGAAGTTCCTGAAGATGCAGAAATCATAGCGTGGTTTGAT
    GCGATAGGGAAAAAACGTGGCTTAATTCGACGTGGTAATGAAATTGATTACGAAGCAGTC
    ATTGAACTGATTATTTATGATATTCGAAATGCTAAAATAGGAAATTATTGTTTTGATATT
    TTTAAAGATATGACTGAGGAATTAGCAAATGACGCTAACAATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    885

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS06505 [old locus tag: NWMN_1153 ]
  • symbol: NWMN_RS06505
  • description: ribosome biogenesis GTPase YlqF
  • length: 294
  • theoretical pI: 9.6036
  • theoretical MW: 33380.5
  • GRAVY: -0.35034

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein synthesisOtherribosome biogenesis GTP-binding protein YlqF (TIGR03596; HMM-score: 364.7)
    Genetic information processingProtein synthesisOtherribosome-associated GTPase EngA (TIGR03594; HMM-score: 72.5)
    Unknown functionGeneralsmall GTP-binding protein domain (TIGR00231; HMM-score: 54.7)
    Genetic information processingProtein synthesisOtherribosome biogenesis GTPase YqeH (TIGR03597; HMM-score: 52.5)
    Genetic information processingProtein synthesisOtherribosome biogenesis GTP-binding protein YsxC (TIGR03598; HMM-score: 49.3)
    Genetic information processingProtein synthesisOtherGTP-binding protein Era (TIGR00436; HMM-score: 43.3)
    Genetic information processingProtein fateProtein modification and repair[FeFe] hydrogenase H-cluster maturation GTPase HydF (TIGR03918; HMM-score: 39.4)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA modification GTPase TrmE (TIGR00450; EC 3.6.-.-; HMM-score: 37)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsferrous iron transport protein B (TIGR00437; HMM-score: 28.5)
    Genetic information processingProtein synthesisOtherObg family GTPase CgtA (TIGR02729; HMM-score: 25.1)
    Unknown functionGeneralGTP-binding protein HflX (TIGR03156; HMM-score: 23.8)
    Unknown functionGeneralGTP-binding protein YchF (TIGR00092; HMM-score: 23)
    Genetic information processingProtein synthesisTranslation factorsribosome small subunit-dependent GTPase A (TIGR00157; EC 3.6.-.-; HMM-score: 21.4)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesLAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 14.7)
    Signal transductionRegulatory functionsProtein interactionsLAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 14.7)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingsignal recognition particle-docking protein FtsY (TIGR00064; HMM-score: 13.1)
    MetabolismEnergy metabolismAmino acids and aminesethanolamine utilization protein, EutP (TIGR02528; HMM-score: 12.8)
  • TheSEED:
  • PFAM:
    P-loop_NTPase (CL0023) MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 72.3)
    FeoB_N; Ferrous iron transport protein B (PF02421; HMM-score: 40.6)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 32)
    AAA_18; AAA domain (PF13238; HMM-score: 21.5)
    Arf; ADP-ribosylation factor family (PF00025; HMM-score: 18.2)
    Dynamin_N; Dynamin family (PF00350; HMM-score: 18)
    ArgK; ArgK protein (PF03308; HMM-score: 14.8)
    Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 14.6)
    AIG1; AIG1 family (PF04548; HMM-score: 14.2)
    SRPRB; Signal recognition particle receptor beta subunit (PF09439; HMM-score: 13.6)
    Septin; Septin (PF00735; HMM-score: 13.3)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 13.1)
    Ras; Ras family (PF00071; HMM-score: 12.9)
    AAA_14; AAA domain (PF13173; HMM-score: 12.7)
    TniB; Bacterial TniB protein (PF05621; HMM-score: 12.2)

Structure, modifications & interactions[edit source | edit]

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.131
    • Ymax_pos: 14
    • Cmax: 0.125
    • Cmax_pos: 14
    • Smax: 0.215
    • Smax_pos: 10
    • Smean: 0.137
    • D: 0.133
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446158867 NCBI
  • RefSeq: WP_000236722 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MVIQWYPGHMAKAKREVSEQLKKVDVVFELVDARIPYSSRNPMIDEVINQKPRVVILNKKDMSNLNEMSKWEQFFIDKGYYPVSVDAKHGKNLKKVEAAAIKATAEKFEREKAKGLKPRAIRAMIVGIPNVGKSTLINKLAKRSIAQTGNKPGVTKQQQWIKVGNALQLLDTPGILWPKFEDEEVGKKLSLTGAIKDSIVHLDEVAIYGLNFLIQNDLARLKSHYNIEVPEDAEIIAWFDAIGKKRGLIRRGNEIDYEAVIELIIYDIRNAKIGNYCFDIFKDMTEELANDANN

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS06505 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]