From AureoWiki
Jump to: navigation, search

NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS02445 [old locus tag: SA0430 ]
  • pan locus tag?: SAUPAN002186000
  • symbol: SA_RS02445
  • pan gene symbol?: gltB
  • synonym:
  • product: glutamate synthase large subunit

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA_RS02445 [old locus tag: SA0430 ]
  • symbol: SA_RS02445
  • product: glutamate synthase large subunit
  • replicon: chromosome
  • strand: +
  • coordinates: 490664..495163
  • length: 4500
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002745 (490664..495163) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    2161
    2221
    2281
    2341
    2401
    2461
    2521
    2581
    2641
    2701
    2761
    2821
    2881
    2941
    3001
    3061
    3121
    3181
    3241
    3301
    3361
    3421
    3481
    3541
    3601
    3661
    3721
    3781
    3841
    3901
    3961
    4021
    4081
    4141
    4201
    4261
    4321
    4381
    4441
    ATGCACAATGAGAAATTAATTAAAGGCTTATATGACTATCGTGAGGAACATGATGCGTGT
    GGTATTGGTTTTTATGCGAATATGGATAATAAAAGGTCTCACGACATCATTGATAAATCG
    CTTGAAATGTTGCGACGCTTAGATCACAGGGGCGGGGTCGGCGCAGATGGCATCACTGGT
    GATGGCGCAGGTATTATGACTGAAATACCTTTTGCATTTTTCAAACAACATGTAACGGAC
    TTTGATATCCCAGGTGAAGGTGAATATGCCGTGGGGTTATTTTTTTCCAAAGAACGCATT
    TTAGGTTCTGAACATGAAGCAGTTTTTAAAAAATATTTTGAAGGCGAAGGGTTATCAATT
    CTTGGTTATCGTAATGTACCAGTTAATAAAGATGCCATTGCTAAACATGTAGCAGATACG
    ATGCCAGTCATTCAACAAGTGTTTATTGATATTAGGGGCATTGAAGATGTTGAAAAGCGT
    TTGTTTTTAGCGAGAAAACAATTAGAGTTCTATTCGACTCAGTGCGATTTAGAATTGTAT
    TTTACGAGCTTATCACGCAAAACAATTGTATATAAAGGTTGGTTACGATCAGACCAAATT
    AAAAAACTATATACAGATTTATCGGATGATTTATATCAATCAAAGCTAGGGTTAGTGCAT
    TCGAGATTTAGTACGAATACATTCCCGAGTTGGAAAAGGGCACATCCTAACCGTATGTTA
    ATGCATAATGGTGAGATTAACACGATTAAAGGTAATGTAAACTGGATGCGAGCACGCCAA
    CATAAATTAATCGAAACATTATTTGGCGAGGATCAACATAAAGTGTTTCAAATTGTCGAT
    GAGGATGGTAGTGACTCTGCTATTGTAGATAATGCGCTAGAGTTCTTATCGTTAGCCATG
    GAGCCAGAAAAGGCAGCGATGCTACTCATACCTGAACCTTGGTTATACAATGAAGCGAAT
    GATGCAAATGTACGTGCGTTTTATGAATTTTATAGTTATTTAATGGAACCGTGGGATGGT
    CCTACAATGATTTCGTTCTGTAACGGTGACAAACTTGGCGCGCTTACAGATAGAAATGGA
    TTACGTCCAGGTCGTTATACGATTACTAAAGATAACTTTATTGTCTTTTCATCTGAAGTG
    GGTGTTGTGGACGTACCTGAAAGTAATGTTGCTTTTAAAGGTCAATTGAATCCTGGAAAG
    TTATTGCTTGTTGATTTTAAACAGAATAAAGTCATTGAAAATAATGATTTAAAAGGTGCG
    ATTGCTGGAGAATTACCATATAAAGCGTGGATTGATAACCATAAAGTTGACTTTGATTTT
    GAAAATATACAATATCAAGATTCGCAATGGAAAGATGAGACGTTATTTAAATTACAACGT
    CAGTTTGCATACACGAAAGAAGAGATTCATAAGTATATTCAGGAACTTGTAGAAGGTAAG
    AAGGATCCTATCGGTGCAATGGGATATGATGCGCCAATTGCAGTGTTGAACGAGCGACCA
    GAATCACTATTTAATTACTTTAAACAGCTGTTTGCACAAGTTACGAATCCACCAATTGAT
    GCGTATCGTGAAAAAATCGTAACGAGTGAACTTTCTTATTTAGGTGGCGAAGGTAACTTA
    CTAGCACCTGACGAAACGGTTTTAGATCGTATTCAATTGAAAAGGCCGGTATTGAATGAA
    TCACACTTAGCAGCGATTGATCAGGAACATTTTAAATTAACTTATTTATCAACGGTATAT
    GAAGGGGATTTGGAAGATGCGTTAGAAGCATTAGGCCGAGAAGCAGTGAATGCTGTAAAG
    CAAGGCGCTCAAATTCTAGTGTTAGATGACAGTGGATTAGTTGATAGCAATGGCTTTGCA
    ATGCCGATGTTACTCGCAATAAGTCATGTGCATCAATTACTTATTAAAGCAGATTTACGT
    ATGTCTACAAGTTTAGTCGCTAAATCTGGTGAGACACGAGAAGTGCATCATGTTGCTTGT
    TTACTCGCATATGGCGCGAATGCAATTGTGCCATACCTAGCGCAACGTACAGTTGAACAA
    CTGACATTGACAGAAGGGTTACAAGGCACCGTTGTCGATAATGTTAAGACATATACGGAT
    GTATTGTCAGAAGGTGTCATTAAAGTAATGGCTAAGATGGGAATTTCGACAGTGCAAAGT
    TATCAAGGTGCACAAATATTTGAAGCGATTGGCTTGTCTCATGATGTGATTGATCGTTAT
    TTTACTGGGACACAGTCTAAGTTATCGGGTATTTCGATTGATCAAATTGATGCTGAAAAT
    AAAGCACGTCAACAAAGTGATGATAATTATCTTGCATCAGGTAGTACATTTCAATGGAGA
    CAACAAGGTCAACATCATGCTTTTAATCCGGAATCTATTTTCTTATTGCAGCACGCATGT
    AAAGAAAATGACTATGCGCAATTTAAAGCATACTCTGAAGCGGTGAACAAAAATAGAACA
    GATCACATTAGACATTTACTTGAATTTAAAGCATGTACACCGATTGACATCGACCAAGTT
    GAACCGGTAAGTGACATTGTCAAACGCTTTAATACAGGGGCGATGAGTTATGGATCGATT
    TCAGCGGAAGCACATGAAACGTTAGCACAAGCCATGAACCAATTAGGTGGAAAGAGTAAT
    AGTGGTGAAGGTGGCGAAGATGCAAAACGTTATGAAGTACAAGTTGATGGAAGCAACAAA
    GTAAGTGCGATTAAACAAGTTGCTTCTGGGCGTTTTGGTGTAACTAGTGATTATTTACAA
    CATGCCAAAGAAATTCAAATTAAAGTTGCGCAAGGTGCAAAGCCTGGTGAAGGTGGTCAA
    TTACCTGGTACTAAGGTATATCCGTGGATTGCAAAGACAAGAGGGTCAACGCCAGGTATC
    GGTCTGATTTCACCACCGCCACATCATGATATTTATTCAATAGAAGATTTAGCGCAACTG
    ATACATGATTTGAAAAATGCGAATAAAGATGCAGATATCGCGGTAAAATTAGTTTCGAAA
    ACAGGTGTTGGTACCATTGCATCTGGGGTGGCAAAAGCATTTGCAGATAAAATTGTCATC
    AGTGGTTACGATGGTGGTACAGGGGCTTCACCTAAAACGAGTATTCAGCATGCCGGTGTT
    CCTTGGGAGATTGGTTTAGCAGAAACACATCAAACATTAAAACTAAATGACTTAAGAAGT
    CGTGTTAAGTTAGAAACAGACGGTAAGTTATTAACTGGTAAAGATGTAGCGTACGCATGT
    GCGCTTGGAGCGGAAGAATTTGGATTTGCAACTGCACCATTAGTGGTGTTGGGCTGTATT
    ATGATGCGTGTATGCCATAAAGATACATGTCCAGTAGGAGTTGCAACTCAAAACAAAGAT
    TTACGTGCTTTATATAGAGGTAAAGCACATCATGTTGTTAATTTTATGCATTTTATTGCA
    CAAGAATTAAGAGAAATTTTAGCATCTTTAGGTTTGAAACGTGTAGAAGACTTAGTTGGA
    AGAACTGATTTATTACAACGATCATCAACATTAAAAGCGAATAGCAAAGTGGCTAGTATT
    GATGTTGAAAAACTGTTATGTCCTTTCGATGGGCCAAACACAAAAGAAATTCAACAAAAT
    CATAATCTTGAGCATGGATTTGATTTAACAAATTTATATGAAGTAACGAAGCCATATATT
    GCTGAAGGACGTCGCTATACAGGTAGCTTTACAGTAAATAATGAACAACGTGATGTAGGA
    GTTATTACAGGTAGTGAGATTTCGAAACAATATGGAGAAGCAGGACTTCCTGAAAATACA
    ATTAATGTTTATACGAATGGTCATGCTGGTCAAAGTCTTGCAGCATATGCACCGAAAGGC
    TTAATGATTCATCATACTGGAGATGCGAATGACTATGTTGGTAAAGGATTATCTGGTGGT
    ACGGTCATTGTCAAAGCACCTTTTGAAGAACGACAAAATGAAATTATTGCTGGTAACGTC
    TCATTCTATGGTGCGACAGGTGGTAAGGCATTTATTAACGGTAGTGCAGGAGAAAGATTC
    TGTATTAGAAATAGTGGTGTAGATGTTGTCGTTGAAGGTATCGGTGACCATGGATTAGAG
    TACATGACTGGTGGACATGTCATTAATTTAGGTGATGTAGGTAAGAACTTCGGTCAAGGT
    ATGAGTGGTGGTATTGCTTACGTTATCCCGTCTGATGTAGAAGCTTTTGTTGAAAATAAT
    CAACTAGATACGCTTTCGTTTACAAAGATTAAACACCAAGAAGAAAAAGCATTCATTAAG
    CAAATGCTGGAAGAACATGTGTCACACACGAATAGTACGAGAGCGATTCATGTGTTAAAA
    CATTTTGATCGCATTGAAGATGTCGTCGTTAAAGTTATTCCTAAAGATTATCAATTAATG
    ATGCAAAAAATTCATTTGCACAAATCATTACATGACAATGAAGATGAAGCGATGTTAGCT
    GCATTTTACGATGACAGTAAAACAATCGACGCTAAACATAAACCAGCCGTTGTGTATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2160
    2220
    2280
    2340
    2400
    2460
    2520
    2580
    2640
    2700
    2760
    2820
    2880
    2940
    3000
    3060
    3120
    3180
    3240
    3300
    3360
    3420
    3480
    3540
    3600
    3660
    3720
    3780
    3840
    3900
    3960
    4020
    4080
    4140
    4200
    4260
    4320
    4380
    4440
    4500

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA_RS02445 [old locus tag: SA0430 ]
  • symbol: SA_RS02445
  • description: glutamate synthase large subunit
  • length: 1499
  • theoretical pI: 6.00929
  • theoretical MW: 166259
  • GRAVY: -0.313876

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    formylmethanofuran dehydrogenase subunit C (TIGR03122; EC 1.2.99.5; HMM-score: 28.2)
  • TheSEED:
  • PFAM:
    TIM_barrel (CL0036) Glu_synthase; Conserved region in glutamate synthase (PF01645; HMM-score: 521.3)
    NTN (CL0052) GATase_2; Glutamine amidotransferases class-II (PF00310; HMM-score: 514.4)
    TIM_barrel (CL0036) Glu_syn_central; Glutamate synthase central domain (PF04898; HMM-score: 330.4)
    no clan definedGXGXG; GXGXG motif (PF01493; HMM-score: 224.4)
    TIM_barrel (CL0036) FMN_dh; FMN-dependent dehydrogenase (PF01070; HMM-score: 9.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA_RS11130(deoA)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    SA_RS09855(gatA)glutamyl-tRNA(Gln) amidotransferase subunit A  [1] (data from MRSA252)
    SA_RS01275formate acetyltransferase  [1] (data from MRSA252)
    SA_RS0265050S ribosomal protein L25/general stress protein Ctc  [1] (data from MRSA252)
    SA_RS02810pyridoxal 5'-phosphate synthase lyase subunit PdxS  [1] (data from MRSA252)
    SA_RS0290550S ribosomal protein L11  [1] (data from MRSA252)
    SA_RS0291050S ribosomal protein L1  [1] (data from MRSA252)
    SA_RS0291550S ribosomal protein L10  [1] (data from MRSA252)
    SA_RS0292050S ribosomal protein L7/L12  [1] (data from MRSA252)
    SA_RS02935DNA-directed RNA polymerase subunit beta'  [1] (data from MRSA252)
    SA_RS02955elongation factor G  [1] (data from MRSA252)
    SA_RS02960elongation factor Tu  [1] (data from MRSA252)
    SA_RS030703-hexulose-6-phosphate synthase  [1] (data from MRSA252)
    SA_RS03645hypothetical protein  [1] (data from MRSA252)
    SA_RS04140aldehyde dehydrogenase  [1] (data from MRSA252)
    SA_RS041552,3-bisphosphoglycerate-independent phosphoglycerate mutase  [1] (data from MRSA252)
    SA_RS04160enolase  [1] (data from MRSA252)
    SA_RS04540D-alanine--poly(phosphoribitol) ligase subunit 2  [1] (data from MRSA252)
    SA_RS04575NADH dehydrogenase  [1] (data from MRSA252)
    SA_RS04680glucose-6-phosphate isomerase  [1] (data from MRSA252)
    SA_RS04785beta-ketoacyl-[acyl-carrier-protein] synthase II  [1] (data from MRSA252)
    SA_RS04915enoyl-ACP reductase  [1] (data from MRSA252)
    SA_RS05295phosphocarrier protein HPr  [1] (data from MRSA252)
    SA_RS05350pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SA_RS05620thiol reductase thioredoxin  [1] (data from MRSA252)
    SA_RS05860cell division protein FtsZ  [1] (data from MRSA252)
    SA_RS06085beta-ketoacyl-ACP reductase  [1] (data from MRSA252)
    SA_RS06165succinyl-CoA ligase subunit beta  [1] (data from MRSA252)
    SA_RS0622530S ribosomal protein S2  [1] (data from MRSA252)
    SA_RS06295translation initiation factor IF-2  [1] (data from MRSA252)
    SA_RS06490glutamine synthetase  [1] (data from MRSA252)
    SA_RS06690transketolase  [1] (data from MRSA252)
    SA_RS07060dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex  [1] (data from MRSA252)
    SA_RS07125peptide-methionine (R)-S-oxide reductase  [1] (data from MRSA252)
    SA_RS07360nucleoside-diphosphate kinase  [1] (data from MRSA252)
    SA_RS0740030S ribosomal protein S1  [1] (data from MRSA252)
    SA_RS07605phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)  [1] (data from MRSA252)
    SA_RS07730glycine dehydrogenase  [1] (data from MRSA252)
    SA_RS07880glycine--tRNA ligase  [1] (data from MRSA252)
    SA_RS08135hypothetical protein  [1] (data from MRSA252)
    SA_RS0829550S ribosomal protein L21  [1] (data from MRSA252)
    SA_RS08435trigger factor  [1] (data from MRSA252)
    SA_RS08505aldehyde dehydrogenase  [1] (data from MRSA252)
    SA_RS08545isocitrate dehydrogenase (NADP(+))  [1] (data from MRSA252)
    SA_RS08560pyruvate kinase  [1] (data from MRSA252)
    SA_RS08565ATP-dependent 6-phosphofructokinase  [1] (data from MRSA252)
    SA_RS08625universal stress protein UspA  [1] (data from MRSA252)
    SA_RS08630acetate kinase  [1] (data from MRSA252)
    SA_RS0867530S ribosomal protein S4  [1] (data from MRSA252)
    SA_RS08860D-alanine aminotransferase  [1] (data from MRSA252)
    SA_RS09005transaldolase  [1] (data from MRSA252)
    SA_RS09850aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B  [1] (data from MRSA252)
    SA_RS10535molecular chaperone GroEL  [1] (data from MRSA252)
    SA_RS10945UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [1] (data from MRSA252)
    SA_RS11010uracil phosphoribosyltransferase  [1] (data from MRSA252)
    SA_RS11070UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [1] (data from MRSA252)
    SA_RS11075fructose-bisphosphate aldolase  [1] (data from MRSA252)
    SA_RS11145purine-nucleoside phosphorylase  [1] (data from MRSA252)
    SA_RS11245glutamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    SA_RS1160030S ribosomal protein S9  [1] (data from MRSA252)
    SA_RS1163050S ribosomal protein L17  [1] (data from MRSA252)
    SA_RS11635DNA-directed RNA polymerase subunit alpha  [1] (data from MRSA252)
    SA_RS11660adenylate kinase  [1] (data from MRSA252)
    SA_RS1168030S ribosomal protein S5  [1] (data from MRSA252)
    SA_RS1169050S ribosomal protein L6  [1] (data from MRSA252)
    SA_RS1172550S ribosomal protein L29  [1] (data from MRSA252)
    SA_RS1174050S ribosomal protein L22  [1] (data from MRSA252)
    SA_RS1176050S ribosomal protein L4  [1] (data from MRSA252)
    SA_RS1177030S ribosomal protein S10  [1] (data from MRSA252)
    SA_RS13420L-glutamate gamma-semialdehyde dehydrogenase  [1] (data from MRSA252)
    SA_RS13730class I fructose-bisphosphate aldolase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 1.78
    • Cytoplasmic Membrane Score: 8.16
    • Cellwall Score: 0.06
    • Extracellular Score: 0.01
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.104
    • Ymax_pos: 56
    • Cmax: 0.121
    • Cmax_pos: 36
    • Smax: 0.12
    • Smax_pos: 49
    • Smean: 0.073
    • D: 0.092
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446473488 NCBI
  • RefSeq: WP_000551342 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MHNEKLIKGLYDYREEHDACGIGFYANMDNKRSHDIIDKSLEMLRRLDHRGGVGADGITGDGAGIMTEIPFAFFKQHVTDFDIPGEGEYAVGLFFSKERILGSEHEAVFKKYFEGEGLSILGYRNVPVNKDAIAKHVADTMPVIQQVFIDIRGIEDVEKRLFLARKQLEFYSTQCDLELYFTSLSRKTIVYKGWLRSDQIKKLYTDLSDDLYQSKLGLVHSRFSTNTFPSWKRAHPNRMLMHNGEINTIKGNVNWMRARQHKLIETLFGEDQHKVFQIVDEDGSDSAIVDNALEFLSLAMEPEKAAMLLIPEPWLYNEANDANVRAFYEFYSYLMEPWDGPTMISFCNGDKLGALTDRNGLRPGRYTITKDNFIVFSSEVGVVDVPESNVAFKGQLNPGKLLLVDFKQNKVIENNDLKGAIAGELPYKAWIDNHKVDFDFENIQYQDSQWKDETLFKLQRQFAYTKEEIHKYIQELVEGKKDPIGAMGYDAPIAVLNERPESLFNYFKQLFAQVTNPPIDAYREKIVTSELSYLGGEGNLLAPDETVLDRIQLKRPVLNESHLAAIDQEHFKLTYLSTVYEGDLEDALEALGREAVNAVKQGAQILVLDDSGLVDSNGFAMPMLLAISHVHQLLIKADLRMSTSLVAKSGETREVHHVACLLAYGANAIVPYLAQRTVEQLTLTEGLQGTVVDNVKTYTDVLSEGVIKVMAKMGISTVQSYQGAQIFEAIGLSHDVIDRYFTGTQSKLSGISIDQIDAENKARQQSDDNYLASGSTFQWRQQGQHHAFNPESIFLLQHACKENDYAQFKAYSEAVNKNRTDHIRHLLEFKACTPIDIDQVEPVSDIVKRFNTGAMSYGSISAEAHETLAQAMNQLGGKSNSGEGGEDAKRYEVQVDGSNKVSAIKQVASGRFGVTSDYLQHAKEIQIKVAQGAKPGEGGQLPGTKVYPWIAKTRGSTPGIGLISPPPHHDIYSIEDLAQLIHDLKNANKDADIAVKLVSKTGVGTIASGVAKAFADKIVISGYDGGTGASPKTSIQHAGVPWEIGLAETHQTLKLNDLRSRVKLETDGKLLTGKDVAYACALGAEEFGFATAPLVVLGCIMMRVCHKDTCPVGVATQNKDLRALYRGKAHHVVNFMHFIAQELREILASLGLKRVEDLVGRTDLLQRSSTLKANSKVASIDVEKLLCPFDGPNTKEIQQNHNLEHGFDLTNLYEVTKPYIAEGRRYTGSFTVNNEQRDVGVITGSEISKQYGEAGLPENTINVYTNGHAGQSLAAYAPKGLMIHHTGDANDYVGKGLSGGTVIVKAPFEERQNEIIAGNVSFYGATGGKAFINGSAGERFCIRNSGVDVVVEGIGDHGLEYMTGGHVINLGDVGKNFGQGMSGGIAYVIPSDVEAFVENNQLDTLSFTKIKHQEEKAFIKQMLEEHVSHTNSTRAIHVLKHFDRIEDVVVKVIPKDYQLMMQKIHLHKSLHDNEDEAMLAAFYDDSKTIDAKHKPAVVY

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA_RS02445 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 1.49 1.50 1.51 1.52 1.53 1.54 1.55 1.56 1.57 1.58 1.59 1.60 1.61 1.62 1.63 1.64 1.65 1.66 1.67 1.68 1.69 1.70 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]