From AureoWiki
Jump to: navigation, search

NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS02460 [old locus tag: SA0432 ]
  • pan locus tag?: SAUPAN002190000
  • symbol: SA_RS02460
  • pan gene symbol?: treP
  • synonym:
  • product: PTS ascorbate transporter subunit IIA

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA_RS02460 [old locus tag: SA0432 ]
  • symbol: SA_RS02460
  • product: PTS ascorbate transporter subunit IIA
  • replicon: chromosome
  • strand: +
  • coordinates: 497474..498901
  • length: 1428
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002745 (497474..498901) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    ATGGCTGTAAAAAGAGAAGATGTAAAAGCCATCGTAAGCGCTATTGGGGGAAAAGAAAAT
    CTTGAAGCTGCAACGCATTGTGTAACACGATTACGTTTAGTGCTTAAAGATGAAAGCAAA
    GTTGATAAAGACGCATTAAGTAATAACGCGTTGGTCAAGGGGCAGTTCAAAGCAGACCAT
    CAATATCAAATTGTCATTGGTCCAGGAACAGTCGATGAAGTGTATAAGCAGTTTATTGAT
    GAAACAGGTGCTCAAGAAGCTTCGAAAGATGAAGCGAAACAAGCAGCTGCGAAAAAAGGG
    AATCCAGTACAACGTTTGATCAAATTGTTAGGGGATATTTTTATACCAATATTACCTGCG
    ATTGTGACAGCTGGTTTGTTAATGGGGATCAATAATTTACTTACAATGAAAGGTTTATTT
    GGTCCAAAAGCACTTATTGAGATGTATCCGCAAATTGCTGATATTTCAAACATCATTAAT
    GTGATTGCGAGTACGGCATTTATTTTCTTACCAGCATTAATTGGTTGGAGTAGTATGCGT
    GTATTTGGTGGTAGTCCGATTCTAGGCATAGTCTTAGGTTTGATTTTAATGCATCCGCAA
    TTAGTATCTCAGTATGATTTGGCAAAAGGGAATATTCCGACGTGGAACTTATTTGGCTTA
    GAGATTAAGCAGTTGAATTACCAAGGTCAAGTGTTGCCTGTTTTAATTGCAGCTTATGTT
    CTAGCTAAAATTGAAAAAGGATTAAATAAAGTCGTTCACGATTCGATAAAAATGTTGGTC
    GTTGGACCCGTAGCGCTTTTAGTTACTGGATTTTTAGCATTTATTATCATTGGACCAGTT
    GCATTATTGATTGGTACAGGTATTACATCTGGTGTTACATTTATATTCCAACATGCAGGA
    TGGCTTGGCGGAGCAATATATGGATTGTTATATGCACCACTTGTAATTACAGGACTACAC
    CATATGTTTTTAGCAGTAGATTTCCAATTGATGGGTAGCAGCTTAGGTGGTACGTATTTA
    TGGCCAATTGTTGCGATTTCCAATATTTGTCAGGGCTCTGCAGCATTTGGAGCATGGTTT
    GTCTATAAACGTCGTAAAATGGTTAAAGAAGAAGGCTTGGCATTAACATCTTGTATTTCT
    GCTATGTTAGGTGTTACTGAACCAGCTATGTTTGGTGTGAACTTACCTTTGAAATATCCA
    TTTATCGCTGCGATATCAACGTCTTGTGTATTGGGGGCAATCGTTGGTATGAATAACGTA
    CTTGGAAAAGTTGGTGTTGGTGGCGTGCCAGCATTCATTTCAATTCAAAAAGAATTTTGG
    CCAGTATATCTTATTGTGACAGCTATTGCTATTGTTGTACCATGTATACTAACAATTGTG
    ATGTCTCATTTTAGTAAACAAAAAGCGAAAGAAATTGTTGAAGATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1428

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA_RS02460 [old locus tag: SA0432 ]
  • symbol: SA_RS02460
  • description: PTS ascorbate transporter subunit IIA
  • length: 475
  • theoretical pI: 9.1912
  • theoretical MW: 50937.3
  • GRAVY: 0.626737

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    PTS system, trehalose-specific IIBC component (TIGR01992; EC 2.7.1.69; HMM-score: 703.8)
    PTS system, sucrose-specific IIBC component (TIGR01996; EC 2.7.1.69; HMM-score: 514.4)
    PTS system, beta-glucoside-specific IIABC component (TIGR01995; EC 2.7.1.69; HMM-score: 340.9)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsPTS system, maltose and glucose-specific subfamily, IIC component (TIGR00852; HMM-score: 234.8)
    Signal transductionSignal transductionPTSPTS system, maltose and glucose-specific subfamily, IIC component (TIGR00852; HMM-score: 234.8)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsPTS system, glucose-like IIB component (TIGR00826; EC 2.7.1.69; HMM-score: 84)
    Signal transductionSignal transductionPTSPTS system, glucose-like IIB component (TIGR00826; EC 2.7.1.69; HMM-score: 84)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsPTS system, N-acetylglucosamine-specific IIBC component (TIGR01998; EC 2.7.1.69; HMM-score: 44.3)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsPTS system, maltose and glucose-specific IIBC component (TIGR02004; EC 2.7.1.69; HMM-score: 38)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsPTS system, alpha-glucoside-specific IIBC component (TIGR02005; EC 2.7.1.69; HMM-score: 37.6)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsPTS system, glucose-specific IIBC component (TIGR02002; EC 2.7.1.69; HMM-score: 25.2)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsPTS system, IIBC component (TIGR02003; EC 2.7.1.69; HMM-score: 22.1)
  • TheSEED:
  • PFAM:
    PTS_EIIC (CL0493) PTS_EIIC; Phosphotransferase system, EIIC (PF02378; HMM-score: 142.3)
    no clan definedPTS_EIIB; phosphotransferase system, EIIB (PF00367; HMM-score: 57.4)
    MotA_ExbB; MotA/TolQ/ExbB proton channel family (PF01618; HMM-score: 12.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA_RS09855(gatA)glutamyl-tRNA(Gln) amidotransferase subunit A  [1] (data from MRSA252)
    SA_RS00150DNA polymerase III subunit beta  [1] (data from MRSA252)
    SA_RS01275formate acetyltransferase  [1] (data from MRSA252)
    SA_RS01365L-lactate dehydrogenase  [1] (data from MRSA252)
    SA_RS01960acetyl-CoA acyltransferase  [1] (data from MRSA252)
    SA_RS02095alkyl hydroperoxide reductase subunit C  [1] (data from MRSA252)
    SA_RS02150GMP synthase (glutamine-hydrolyzing)  [1] (data from MRSA252)
    SA_RS02710cysteine synthase  [1] (data from MRSA252)
    SA_RS02735lysine--tRNA ligase  [1] (data from MRSA252)
    SA_RS02900transcription termination/antitermination protein NusG  [1] (data from MRSA252)
    SA_RS0291050S ribosomal protein L1  [1] (data from MRSA252)
    SA_RS0291550S ribosomal protein L10  [1] (data from MRSA252)
    SA_RS0292050S ribosomal protein L7/L12  [1] (data from MRSA252)
    SA_RS02930DNA-directed RNA polymerase subunit beta  [1] (data from MRSA252)
    SA_RS02955elongation factor G  [1] (data from MRSA252)
    SA_RS02960elongation factor Tu  [1] (data from MRSA252)
    SA_RS03250zinc-dependent alcohol dehydrogenase  [1] (data from MRSA252)
    SA_RS03380metal ABC transporter substrate-binding protein  [1] (data from MRSA252)
    SA_RS04140aldehyde dehydrogenase  [1] (data from MRSA252)
    SA_RS04150triose-phosphate isomerase  [1] (data from MRSA252)
    SA_RS04160enolase  [1] (data from MRSA252)
    SA_RS04330glycine cleavage system protein H  [1] (data from MRSA252)
    SA_RS04420ABC transporter ATP-binding protein  [1] (data from MRSA252)
    SA_RS04895NAD(+) kinase  [1] (data from MRSA252)
    SA_RS04935hypothetical protein  [1] (data from MRSA252)
    SA_RS05295phosphocarrier protein HPr  [1] (data from MRSA252)
    SA_RS05350pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SA_RS05355pyruvate dehydrogenase E1 component subunit beta  [1] (data from MRSA252)
    SA_RS05360dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex  [1] (data from MRSA252)
    SA_RS05365dihydrolipoyl dehydrogenase  [1] (data from MRSA252)
    SA_RS05620thiol reductase thioredoxin  [1] (data from MRSA252)
    SA_RS06165succinyl-CoA ligase subunit beta  [1] (data from MRSA252)
    SA_RS0622530S ribosomal protein S2  [1] (data from MRSA252)
    SA_RS06235elongation factor Ts  [1] (data from MRSA252)
    SA_RS06265proline--tRNA ligase  [1] (data from MRSA252)
    SA_RS06295translation initiation factor IF-2  [1] (data from MRSA252)
    SA_RS06490glutamine synthetase  [1] (data from MRSA252)
    SA_RS06730aconitate hydratase  [1] (data from MRSA252)
    SA_RS07060dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex  [1] (data from MRSA252)
    SA_RS070652-oxoglutarate dehydrogenase E1 component  [1] (data from MRSA252)
    SA_RS07385DNA-binding protein HU  [1] (data from MRSA252)
    SA_RS07605phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)  [1] (data from MRSA252)
    SA_RS07820superoxide dismutase  [1] (data from MRSA252)
    SA_RS07880glycine--tRNA ligase  [1] (data from MRSA252)
    SA_RS08135hypothetical protein  [1] (data from MRSA252)
    SA_RS0829550S ribosomal protein L21  [1] (data from MRSA252)
    SA_RS08435trigger factor  [1] (data from MRSA252)
    SA_RS08480threonine--tRNA ligase  [1] (data from MRSA252)
    SA_RS08505aldehyde dehydrogenase  [1] (data from MRSA252)
    SA_RS08545isocitrate dehydrogenase (NADP(+))  [1] (data from MRSA252)
    SA_RS08560pyruvate kinase  [1] (data from MRSA252)
    SA_RS08630acetate kinase  [1] (data from MRSA252)
    SA_RS0867530S ribosomal protein S4  [1] (data from MRSA252)
    SA_RS08760formate--tetrahydrofolate ligase  [1] (data from MRSA252)
    SA_RS09005transaldolase  [1] (data from MRSA252)
    SA_RS09850aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B  [1] (data from MRSA252)
    SA_RS10535molecular chaperone GroEL  [1] (data from MRSA252)
    SA_RS11010uracil phosphoribosyltransferase  [1] (data from MRSA252)
    SA_RS11070UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [1] (data from MRSA252)
    SA_RS11245glutamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    SA_RS11430Asp23/Gls24 family envelope stress response protein  [1] (data from MRSA252)
    SA_RS1160550S ribosomal protein L13  [1] (data from MRSA252)
    SA_RS1164030S ribosomal protein S11  [1] (data from MRSA252)
    SA_RS1167050S ribosomal protein L15  [1] (data from MRSA252)
    SA_RS1168030S ribosomal protein S5  [1] (data from MRSA252)
    SA_RS1168550S ribosomal protein L18  [1] (data from MRSA252)
    SA_RS1170550S ribosomal protein L5  [1] (data from MRSA252)
    SA_RS1172030S ribosomal protein S17  [1] (data from MRSA252)
    SA_RS1173530S ribosomal protein S3  [1] (data from MRSA252)
    SA_RS1174050S ribosomal protein L22  [1] (data from MRSA252)
    SA_RS1174530S ribosomal protein S19  [1] (data from MRSA252)
    SA_RS1175550S ribosomal protein L23  [1] (data from MRSA252)
    SA_RS1176050S ribosomal protein L4  [1] (data from MRSA252)
    SA_RS12625amino acid ABC transporter substrate-binding protein  [1] (data from MRSA252)
    SA_RS13375hydroxymethylglutaryl-CoA synthase  [1] (data from MRSA252)
    SA_RS13420L-glutamate gamma-semialdehyde dehydrogenase  [1] (data from MRSA252)
    SA_RS13735malate:quinone oxidoreductase  [1] (data from MRSA252)
    SA_RS13915ornithine carbamoyltransferase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 9
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.155
    • Ymax_pos: 24
    • Cmax: 0.207
    • Cmax_pos: 24
    • Smax: 0.209
    • Smax_pos: 41
    • Smean: 0.115
    • D: 0.139
  • predicted transmembrane helices (TMHMM): 9

Accession numbers[edit source | edit]

  • GI: 446201506 NCBI
  • RefSeq: WP_000279361 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MAVKREDVKAIVSAIGGKENLEAATHCVTRLRLVLKDESKVDKDALSNNALVKGQFKADHQYQIVIGPGTVDEVYKQFIDETGAQEASKDEAKQAAAKKGNPVQRLIKLLGDIFIPILPAIVTAGLLMGINNLLTMKGLFGPKALIEMYPQIADISNIINVIASTAFIFLPALIGWSSMRVFGGSPILGIVLGLILMHPQLVSQYDLAKGNIPTWNLFGLEIKQLNYQGQVLPVLIAAYVLAKIEKGLNKVVHDSIKMLVVGPVALLVTGFLAFIIIGPVALLIGTGITSGVTFIFQHAGWLGGAIYGLLYAPLVITGLHHMFLAVDFQLMGSSLGGTYLWPIVAISNICQGSAAFGAWFVYKRRKMVKEEGLALTSCISAMLGVTEPAMFGVNLPLKYPFIAAISTSCVLGAIVGMNNVLGKVGVGGVPAFISIQKEFWPVYLIVTAIAIVVPCILTIVMSHFSKQKAKEIVED

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA_RS02460 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 1.49 1.50 1.51 1.52 1.53 1.54 1.55 1.56 1.57 1.58 1.59 1.60 1.61 1.62 1.63 1.64 1.65 1.66 1.67 1.68 1.69 1.70 1.71 1.72 1.73 1.74 1.75 1.76 1.77 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]