From AureoWiki
Jump to: navigation, search

NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS06730 [old locus tag: SA1184 ]
  • pan locus tag?: SAUPAN003735000
  • symbol: SA_RS06730
  • pan gene symbol?: citB
  • synonym:
  • product: aconitate hydratase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA_RS06730 [old locus tag: SA1184 ]
  • symbol: SA_RS06730
  • product: aconitate hydratase
  • replicon: chromosome
  • strand: +
  • coordinates: 1349289..1351994
  • length: 2706
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002745 (1349289..1351994) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    2161
    2221
    2281
    2341
    2401
    2461
    2521
    2581
    2641
    2701
    ATGGCTGCAAATTTTAAAGAGCAATCAAAAAAACATTTTGACTTGAATGGCCAAAGTTAT
    ACTTACTATGATTTAAAAGCTGTAGAAGAGCAAGGTATTACTAAAGTTTCCAATTTACCT
    TATTCAATTCGTGTTTTGTTAGAATCTTTACTTCGTCAAGAAGATGATTTTGTAATTACA
    GACGATCATATTAAAGCTTTAAGTCAGTTTGGAAAAGATGGAAATGAAGGCGAGGTACCA
    TTTAAACCTTCTCGTGTTATTTTACAAGATTTCACAGGTGTACCAGCCGTAGTTGATTTA
    GCTTCTTTACGTAAAGCAATGGATGACGTTGGGGGAGATATTACTAAAATTAATCCAGAA
    GTACCGGTGGATTTAGTTATTGACCACTCAGTTCAAGTGGATAGCTATGCAAATCCAGAA
    GCTCTTGAACGTAATATGAAATTAGAATTTGAACGTAACTATGAACGTTATCAGTTTTTA
    AATTGGGCAACGAAAGCATTTGATAATTACAATGCAGTTCCTCCTGCAACTGGAATAGTT
    CACCAAGTTAACTTAGAATATTTAGCAAGTGTTGTACATGTTCGTGATGTAGATGGTGAA
    AAAACTGCATTTCCAGATACATTAGTTGGTACTGATTCACATACAACAATGATAAATGGT
    ATTGGCGTACTAGGATGGGGTGTTGGTGGTATTGAAGCTGAAGCTGGAATGCTTGGACAA
    CCTTCTTATTTCCCAATTCCAGAGGTTATTGGTGTACGACTAGTAAATTCATTACCACAA
    GGCGCAACAGCAACTGATTTAGCGTTAAGAGTAACTCAAGAGCTACGTAAAAAAGGTGTT
    GTTGGTAAATTTGTGGAGTTCTTTGGTCCAGGTGTACAACATTTACCACTAGCAGACCGT
    GCTACAATTGCAAACATGGCACCAGAGTATGGAGCAACTTGCGGATTCTTCCCAGTTGAT
    GATGAATCTCTTAAATATATGAAGTTAACTGGTAGATCAGACGAACATATCGCGCTAGTA
    AAAGAATATTTGAAACAAAACCATATGTTCTTTGATGTTGAGAAAGAAGATCCTAATTAT
    ACAGATGTTATCGAATTGGATTTATCAACAGTTGAAGCATCGCTTTCAGGACCAAAACGT
    CCTCAAGATTTAATTTTCTTAAGTGATATGAAATCATCATTTGAAAATTCTGTAACAGCT
    CCAGCAGGCAACCAAGGACACGGTTTAGATAAAAGTGAATTTGATAAGAAAGCTGAAATT
    AACTTTAAAGATGGATCAAAAGCTACAATGAAAACAGGTGATATTGCAATAGCAGCAATT
    ACATCATGTACAAATACATCTAACCCTTATGTAATGTTAGGTGCAGGTTTAGTTGCTAAA
    AAAGCAGTTGAAAAAGGCTTGAAAGTTCCTGAATACGTTAAAACTTCTCTAGCACCAGGA
    TCAAAAGTTGTTACCGGATATTTAAGAGATGCTGGCTTACAACCTTATTTAGATGATTTA
    GGCTTCAACTTGGTTGGTTATGGATGTACAACTTGTATCGGTAATTCAGGTCCTTTATTA
    CCAGAAATTGAAAAAGCGATTGCTGATGAGGACCTATTAGTGACATCTGTATTATCTGGT
    AACCGTAACTTTGAAGGTCGTATCCATCCTCTTGTTAAAGCCAATTACCTAGCTTCACCA
    CAGTTAGTTGTTGCTTATGCATTAGCTGGAACGGTTGATATTGATTTACAGAATGAACCT
    ATTGGTAAAGGTAATGACGGTGAAGATGTATATTTGAAAGATATTTGGCCATCAATTAAA
    GAAGTTTCAGATACCGTTGATAGTGTTGTAACACCTGAATTATTTATTGAAGAATATAAT
    AACGTATACAATAACAACGAATTATGGAATGAGATTGATGTAACTGATCAACCTCTATAT
    GACTTTGATCCTAATTCAACATACATTCAAAATCCATCATTCTTCCAAGGATTATCTAAA
    GAACCGGGTACGATTGTTCCATTAAATGGTTTACGTGTTATGGGTAAATTCGGTGATTCT
    GTGACAACTGACCACATCTCTCCAGCAGGTGCAATTGGTAAAGATACGCCAGCTGGTAAA
    TATTTACAAGATCATCAAGTGCCTATTCGTGAATTTAATTCATATGGTTCAAGACGTGGT
    AATCACGAAGTAATGGTTCGAGGTACGTTTGCTAATATACGTATTAAAAACCAATTAGCG
    CCAGGTACTGAAGGTGGTTTTACAACTTATTGGCCAACAAATGAAGTAATGCCTATCTTT
    GATGCTGCAATGAAATATAAAGAAGATGGTACAGGTTTAGTTGTATTAGCTGGTAACGAT
    TATGGTATGGGTTCATCTCGTGACTGGGCAGCAAAAGGTACAAACTTATTAGGTGTTAAA
    ACAGTTATTGCACAAAGTTATGAACGTATCCATCGTTCAAATTTAGTTATGATGGGTGTA
    TTACCATTAGAGTTTAAAAAAGGTGAATCAGCTGATTCTCTTGGTCTAGATGGTACAGAA
    GAAATTTCTGTTAATATTGATGAAAATGTTCAACCACATGACTACGTCAAAGTTACTGCT
    AAGAAGCAAGATGGTGATTTGGTAGAATTTGACGCTATGGTTCGTTTTGACTCACTTGTT
    GAAATGGATTACTATCGTCACGGTGGAATTTTACAAATGGTTTTAAGAAATAAATTAGCG
    CAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2160
    2220
    2280
    2340
    2400
    2460
    2520
    2580
    2640
    2700
    2706

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA_RS06730 [old locus tag: SA1184 ]
  • symbol: SA_RS06730
  • description: aconitate hydratase
  • length: 901
  • theoretical pI: 4.58662
  • theoretical MW: 98969
  • GRAVY: -0.276249

Function[edit source | edit]

  • reaction:
    EC 4.2.1.3?  ExPASy
    Aconitate hydrataseCitrate = isocitrate
    EC 4.2.1.99?  ExPASy
    2-methylisocitrate dehydratase(2S,3R)-3-hydroxybutane-1,2,3-tricarboxylate = (Z)-but-2-ene-1,2,3-tricarboxylate + H2O
  • TIGRFAM:
    MetabolismEnergy metabolismTCA cycleaconitate hydratase 1 (TIGR01341; EC 4.2.1.3; HMM-score: 1440.3)
    and 11 more
    2-methylisocitrate dehydratase, Fe/S-dependent (TIGR02333; EC 4.2.1.99; HMM-score: 785.6)
    MetabolismEnergy metabolismTCA cycleaconitate hydratase, mitochondrial (TIGR01340; EC 4.2.1.3; HMM-score: 240.6)
    MetabolismEnergy metabolismTCA cycleputative aconitate hydratase (TIGR01342; EC 4.2.1.3; HMM-score: 239.1)
    homoaconitate hydratase family protein (TIGR01343; HMM-score: 118.3)
    3-isopropylmalate dehydratase, large subunit (TIGR02086; HMM-score: 113.8)
    MetabolismAmino acid biosynthesisPyruvate family3-isopropylmalate dehydratase, large subunit (TIGR02083; EC 4.2.1.33; HMM-score: 110.8)
    MetabolismAmino acid biosynthesisAspartate familyhomoaconitase (TIGR00139; EC 4.2.1.36; HMM-score: 97.8)
    MetabolismAmino acid biosynthesisPyruvate family3-isopropylmalate dehydratase, large subunit (TIGR00170; EC 4.2.1.33; HMM-score: 89.8)
    3-isopropylmalate dehydratase, small subunit (TIGR02087; HMM-score: 48.5)
    MetabolismAmino acid biosynthesisPyruvate family3-isopropylmalate dehydratase, small subunit (TIGR02084; EC 4.2.1.33; HMM-score: 37.5)
    MetabolismAmino acid biosynthesisPyruvate family3-isopropylmalate dehydratase, small subunit (TIGR00171; EC 4.2.1.33; HMM-score: 27.8)
  • TheSEED:
  • PFAM:
    no clan definedAconitase; Aconitase family (aconitate hydratase) (PF00330; HMM-score: 588.2)
    and 1 more
    Leu-IlvD (CL0364) Aconitase_C; Aconitase C-terminal domain (PF00694; HMM-score: 146.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: [4Fe-4S] cluster
  • effectors:
  • protein partners:
    SA_RS07290(asnC)asparagine--tRNA ligase  [1] (data from MRSA252)
    SA_RS11130(deoA)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    SA_RS06280(nusA)transcription termination/antitermination protein NusA  [1] (data from MRSA252)
    SA_RS00150DNA polymerase III subunit beta  [1] (data from MRSA252)
    SA_RS00185serine--tRNA ligase  [1] (data from MRSA252)
    SA_RS00305bleomycin binding protein  [1] (data from MRSA252)
    SA_RS00310aminoglycoside O-nucleotidyltransferase ANT(4')-Ia  [1] (data from MRSA252)
    SA_RS00690immunoglobulin G-binding protein A  [1] (data from MRSA252)
    SA_RS01275formate acetyltransferase  [1] (data from MRSA252)
    SA_RS01365L-lactate dehydrogenase  [1] (data from MRSA252)
    SA_RS014452-C-methyl-D-erythritol 4-phosphate cytidylyltransferase  [1] (data from MRSA252)
    SA_RS02095alkyl hydroperoxide reductase subunit C  [1] (data from MRSA252)
    SA_RS02130hypothetical protein  [1] (data from MRSA252)
    SA_RS02145IMP dehydrogenase  [1] (data from MRSA252)
    SA_RS0265050S ribosomal protein L25/general stress protein Ctc  [1] (data from MRSA252)
    SA_RS02695hypoxanthine-guanine phosphoribosyltransferase  [1] (data from MRSA252)
    SA_RS02710cysteine synthase  [1] (data from MRSA252)
    SA_RS02735lysine--tRNA ligase  [1] (data from MRSA252)
    SA_RS02810pyridoxal 5'-phosphate synthase lyase subunit PdxS  [1] (data from MRSA252)
    SA_RS0290550S ribosomal protein L11  [1] (data from MRSA252)
    SA_RS0291050S ribosomal protein L1  [1] (data from MRSA252)
    SA_RS0291550S ribosomal protein L10  [1] (data from MRSA252)
    SA_RS02935DNA-directed RNA polymerase subunit beta'  [1] (data from MRSA252)
    SA_RS0295030S ribosomal protein S7  [1] (data from MRSA252)
    SA_RS02955elongation factor G  [1] (data from MRSA252)
    SA_RS02960elongation factor Tu  [1] (data from MRSA252)
    SA_RS029702-amino-3-ketobutyrate CoA ligase  [1] (data from MRSA252)
    SA_RS02990branched chain amino acid aminotransferase  [1] (data from MRSA252)
    SA_RS03155phosphate acetyltransferase  [1] (data from MRSA252)
    SA_RS03250zinc-dependent alcohol dehydrogenase  [1] (data from MRSA252)
    SA_RS03265arginine--tRNA ligase  [1] (data from MRSA252)
    SA_RS03380metal ABC transporter substrate-binding protein  [1] (data from MRSA252)
    SA_RS03665MarR family transcriptional regulator  [1] (data from MRSA252)
    SA_RS03910ribonucleotide-diphosphate reductase subunit alpha  [1] (data from MRSA252)
    SA_RS03915ribonucleotide-diphosphate reductase subunit beta  [1] (data from MRSA252)
    SA_RS04020ribosomal subunit interface protein  [1] (data from MRSA252)
    SA_RS04120ATP-dependent Clp protease proteolytic subunit  [1] (data from MRSA252)
    SA_RS04140aldehyde dehydrogenase  [1] (data from MRSA252)
    SA_RS04145phosphoglycerate kinase  [1] (data from MRSA252)
    SA_RS041552,3-bisphosphoglycerate-independent phosphoglycerate mutase  [1] (data from MRSA252)
    SA_RS04325arsenate reductase  [1] (data from MRSA252)
    SA_RS04330glycine cleavage system protein H  [1] (data from MRSA252)
    SA_RS04575NADH dehydrogenase  [1] (data from MRSA252)
    SA_RS04660NAD-specific glutamate dehydrogenase  [1] (data from MRSA252)
    SA_RS04680glucose-6-phosphate isomerase  [1] (data from MRSA252)
    SA_RS04785beta-ketoacyl-[acyl-carrier-protein] synthase II  [1] (data from MRSA252)
    SA_RS04865oligoendopeptidase F  [1] (data from MRSA252)
    SA_RS04915enoyl-ACP reductase  [1] (data from MRSA252)
    SA_RS04935hypothetical protein  [1] (data from MRSA252)
    SA_RS050951,4-dihydroxy-2-naphthoyl-CoA synthase  [1] (data from MRSA252)
    SA_RS05190bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase  [1] (data from MRSA252)
    SA_RS05295phosphocarrier protein HPr  [1] (data from MRSA252)
    SA_RS05300phosphoenolpyruvate--protein phosphotransferase  [1] (data from MRSA252)
    SA_RS05620thiol reductase thioredoxin  [1] (data from MRSA252)
    SA_RS05855cell division protein FtsA  [1] (data from MRSA252)
    SA_RS05895isoleucine--tRNA ligase  [1] (data from MRSA252)
    SA_RS05945carbamoyl-phosphate synthase large chain  [1] (data from MRSA252)
    SA_RS06165succinyl-CoA ligase subunit beta  [1] (data from MRSA252)
    SA_RS0622530S ribosomal protein S2  [1] (data from MRSA252)
    SA_RS06235elongation factor Ts  [1] (data from MRSA252)
    SA_RS06320polyribonucleotide nucleotidyltransferase  [1] (data from MRSA252)
    SA_RS06490glutamine synthetase  [1] (data from MRSA252)
    SA_RS06645catalase  [1] (data from MRSA252)
    SA_RS06690transketolase  [1] (data from MRSA252)
    SA_RS06955ABC transporter ATP-binding protein  [1] (data from MRSA252)
    SA_RS07100N-acetyltransferase  [1] (data from MRSA252)
    SA_RS07120glucose-specific phosphotransferase enzyme IIA component  [1] (data from MRSA252)
    SA_RS07125peptide-methionine (R)-S-oxide reductase  [1] (data from MRSA252)
    SA_RS07360nucleoside-diphosphate kinase  [1] (data from MRSA252)
    SA_RS07385DNA-binding protein HU  [1] (data from MRSA252)
    SA_RS0740030S ribosomal protein S1  [1] (data from MRSA252)
    SA_RS07605phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)  [1] (data from MRSA252)
    SA_RS07725glycine dehydrogenase  [1] (data from MRSA252)
    SA_RS07820superoxide dismutase  [1] (data from MRSA252)
    SA_RS07880glycine--tRNA ligase  [1] (data from MRSA252)
    SA_RS07955molecular chaperone DnaK  [1] (data from MRSA252)
    SA_RS08110transcription elongation factor GreA  [1] (data from MRSA252)
    SA_RS0829550S ribosomal protein L21  [1] (data from MRSA252)
    SA_RS08435trigger factor  [1] (data from MRSA252)
    SA_RS0846050S ribosomal protein L20  [1] (data from MRSA252)
    SA_RS08480threonine--tRNA ligase  [1] (data from MRSA252)
    SA_RS08550citrate synthase  [1] (data from MRSA252)
    SA_RS08560pyruvate kinase  [1] (data from MRSA252)
    SA_RS08565ATP-dependent 6-phosphofructokinase  [1] (data from MRSA252)
    SA_RS08620alanine dehydrogenase  [1] (data from MRSA252)
    SA_RS08630acetate kinase  [1] (data from MRSA252)
    SA_RS086402-Cys peroxiredoxin  [1] (data from MRSA252)
    SA_RS0867530S ribosomal protein S4  [1] (data from MRSA252)
    SA_RS08760formate--tetrahydrofolate ligase  [1] (data from MRSA252)
    SA_RS08780catabolite control protein A  [1] (data from MRSA252)
    SA_RS08860D-alanine aminotransferase  [1] (data from MRSA252)
    SA_RS08865dipeptidase PepV  [1] (data from MRSA252)
    SA_RS09005transaldolase  [1] (data from MRSA252)
    SA_RS09810non-heme ferritin  [1] (data from MRSA252)
    SA_RS09850aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B  [1] (data from MRSA252)
    SA_RS09960manganese-dependent inorganic pyrophosphatase  [1] (data from MRSA252)
    SA_RS10535molecular chaperone GroEL  [1] (data from MRSA252)
    SA_RS10540co-chaperone GroES  [1] (data from MRSA252)
    SA_RS10755anti-sigma B factor RsbW  [1] (data from MRSA252)
    SA_RS10760anti-sigma B factor antagonist  [1] (data from MRSA252)
    SA_RS10940beta-hydroxyacyl-ACP dehydratase  [1] (data from MRSA252)
    SA_RS11010uracil phosphoribosyltransferase  [1] (data from MRSA252)
    SA_RS11070UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [1] (data from MRSA252)
    SA_RS11075fructose-bisphosphate aldolase  [1] (data from MRSA252)
    SA_RS11090DNA-directed RNA polymerase subunit delta  [1] (data from MRSA252)
    SA_RS11145purine-nucleoside phosphorylase  [1] (data from MRSA252)
    SA_RS11150DNA starvation/stationary phase protection protein  [1] (data from MRSA252)
    SA_RS11245glutamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    SA_RS11275phosphoglucosamine mutase  [1] (data from MRSA252)
    SA_RS11430Asp23/Gls24 family envelope stress response protein  [1] (data from MRSA252)
    SA_RS1163050S ribosomal protein L17  [1] (data from MRSA252)
    SA_RS11635DNA-directed RNA polymerase subunit alpha  [1] (data from MRSA252)
    SA_RS11660adenylate kinase  [1] (data from MRSA252)
    SA_RS1167050S ribosomal protein L15  [1] (data from MRSA252)
    SA_RS1167550S ribosomal protein L30  [1] (data from MRSA252)
    SA_RS1169050S ribosomal protein L6  [1] (data from MRSA252)
    SA_RS1170550S ribosomal protein L5  [1] (data from MRSA252)
    SA_RS1173530S ribosomal protein S3  [1] (data from MRSA252)
    SA_RS1174530S ribosomal protein S19  [1] (data from MRSA252)
    SA_RS1175550S ribosomal protein L23  [1] (data from MRSA252)
    SA_RS120602-hydroxyacid dehydrogenase  [1] (data from MRSA252)
    SA_RS12400quinone oxidoreductase  [1] (data from MRSA252)
    SA_RS13255lactate dehydrogenase  [1] (data from MRSA252)
    SA_RS13375hydroxymethylglutaryl-CoA synthase  [1] (data from MRSA252)
    SA_RS13420L-glutamate gamma-semialdehyde dehydrogenase  [1] (data from MRSA252)
    SA_RS13705L-lactate dehydrogenase  [1] (data from MRSA252)
    SA_RS13730class I fructose-bisphosphate aldolase  [1] (data from MRSA252)
    SA_RS13735malate:quinone oxidoreductase  [1] (data from MRSA252)
    SA_RS13915ornithine carbamoyltransferase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.108
    • Ymax_pos: 11
    • Cmax: 0.109
    • Cmax_pos: 3
    • Smax: 0.211
    • Smax_pos: 1
    • Smean: 0.096
    • D: 0.103
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446652398 NCBI
  • RefSeq: WP_000729744 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MAANFKEQSKKHFDLNGQSYTYYDLKAVEEQGITKVSNLPYSIRVLLESLLRQEDDFVITDDHIKALSQFGKDGNEGEVPFKPSRVILQDFTGVPAVVDLASLRKAMDDVGGDITKINPEVPVDLVIDHSVQVDSYANPEALERNMKLEFERNYERYQFLNWATKAFDNYNAVPPATGIVHQVNLEYLASVVHVRDVDGEKTAFPDTLVGTDSHTTMINGIGVLGWGVGGIEAEAGMLGQPSYFPIPEVIGVRLVNSLPQGATATDLALRVTQELRKKGVVGKFVEFFGPGVQHLPLADRATIANMAPEYGATCGFFPVDDESLKYMKLTGRSDEHIALVKEYLKQNHMFFDVEKEDPNYTDVIELDLSTVEASLSGPKRPQDLIFLSDMKSSFENSVTAPAGNQGHGLDKSEFDKKAEINFKDGSKATMKTGDIAIAAITSCTNTSNPYVMLGAGLVAKKAVEKGLKVPEYVKTSLAPGSKVVTGYLRDAGLQPYLDDLGFNLVGYGCTTCIGNSGPLLPEIEKAIADEDLLVTSVLSGNRNFEGRIHPLVKANYLASPQLVVAYALAGTVDIDLQNEPIGKGNDGEDVYLKDIWPSIKEVSDTVDSVVTPELFIEEYNNVYNNNELWNEIDVTDQPLYDFDPNSTYIQNPSFFQGLSKEPGTIVPLNGLRVMGKFGDSVTTDHISPAGAIGKDTPAGKYLQDHQVPIREFNSYGSRRGNHEVMVRGTFANIRIKNQLAPGTEGGFTTYWPTNEVMPIFDAAMKYKEDGTGLVVLAGNDYGMGSSRDWAAKGTNLLGVKTVIAQSYERIHRSNLVMMGVLPLEFKKGESADSLGLDGTEEISVNIDENVQPHDYVKVTAKKQDGDLVEFDAMVRFDSLVEMDYYRHGGILQMVLRNKLAQ

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA_RS06730 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.000 1.001 1.002 1.003 1.004 1.005 1.006 1.007 1.008 1.009 1.010 1.011 1.012 1.013 1.014 1.015 1.016 1.017 1.018 1.019 1.020 1.021 1.022 1.023 1.024 1.025 1.026 1.027 1.028 1.029 1.030 1.031 1.032 1.033 1.034 1.035 1.036 1.037 1.038 1.039 1.040 1.041 1.042 1.043 1.044 1.045 1.046 1.047 1.048 1.049 1.050 1.051 1.052 1.053 1.054 1.055 1.056 1.057 1.058 1.059 1.060 1.061 1.062 1.063 1.064 1.065 1.066 1.067 1.068 1.069 1.070 1.071 1.072 1.073 1.074 1.075 1.076 1.077 1.078 1.079 1.080 1.081 1.082 1.083 1.084 1.085 1.086 1.087 1.088 1.089 1.090 1.091 1.092 1.093 1.094 1.095 1.096 1.097 1.098 1.099 1.100 1.101 1.102 1.103 1.104 1.105 1.106 1.107 1.108 1.109 1.110 1.111 1.112 1.113 1.114 1.115 1.116 1.117 1.118 1.119 1.120 1.121 1.122 1.123 1.124 1.125 1.126 1.127 1.128 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]