From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_1143 [new locus tag: NWMN_RS06450 ]
  • pan locus tag?: SAUPAN003520000
  • symbol: rnc
  • pan gene symbol?: rnc
  • synonym:
  • product: ribonuclease III

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_1143 [new locus tag: NWMN_RS06450 ]
  • symbol: rnc
  • product: ribonuclease III
  • replicon: chromosome
  • strand: +
  • coordinates: 1251851..1252582
  • length: 732
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGTCTAAACAAAAGAAAAGTGAGATAGTTAATCGTTTTAGAAAGCGCTTTGATACTAAA
    ATGACAGAGTTAGGCTTTACTTATCAAAATATTGATTTATACCAACAAGCATTTTCGCAT
    TCGAGTTTTATTAATGATTTTAATATGAATCGTTTAGACCATAATGAGCGTTTAGAGTTT
    TTGGGTGATGCGGTATTAGAATTGACGGTTTCACGATATTTATTTGATAAACATCCCAAC
    TTGCCAGAAGGGAATTTAACAAAAATGCGTGCCACTATTGTATGTGAGCCCTCACTTGTA
    ATATTTGCGAATAAAATTGGATTGAACGAAATGATTTTACTTGGTAAAGGTGAAGAGAAA
    ACAGGGGGACGTACAAGACCATCATTAATATCAGATGCATTCGAAGCATTTATTGGGGCA
    TTGTATTTGGATCAAGGACTAGATATAGTTTGGAAATTTGCTGAGAAAGTCATTTTCCCA
    CATGTAGAACAAAATGAGTTATTAGGCGTGGTAGATTTTAAAACACAATTCCAAGAATAT
    GTGCACCAGCAAAATAAAGGTGATGTAACCTATAATTTAATAAAAGAAGAGGGACCGGCA
    CATCATCGTCTATTCACTTCAGAAGTTATTCTGCAAGGGGAAGCAATAGCTGAAGGTAAA
    GGGAAAACGAAAAAAGAATCAGAACAACGTGCTGCTGAAAGTGCCTATAAGCAATTAAAA
    CAAATTAAATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    732

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_1143 [new locus tag: NWMN_RS06450 ]
  • symbol: Rnc
  • description: ribonuclease III
  • length: 243
  • theoretical pI: 7.23578
  • theoretical MW: 27921.6
  • GRAVY: -0.493416

Function[edit source | edit]

  • reaction:
    EC 3.1.26.3?  ExPASy
    Ribonuclease IIIEndonucleolytic cleavage to 5'-phosphomonoester
  • TIGRFAM:
    Genetic information processingTranscriptionRNA processingribonuclease III (TIGR02191; EC 3.1.26.3; HMM-score: 266.4)
    seadornavirus double-stranded RNA-binding protein (TIGR04238; HMM-score: 17.2)
  • TheSEED:  
    Cell Division and Cell CycleCell Division and Cell Cycle - no subcategoryTwo cell division clusters relating to chromosome partitioning Ribonuclease III (EC 3.1.26.3) 
    RNA MetabolismRNA processing and modificationRNA processing and degradation, bacterial Ribonuclease III (EC 3.1.26.3) 
    CBSS-176299.4.peg.1292 Ribonuclease III (EC 3.1.26.3) 
    COG1399 Ribonuclease III (EC 3.1.26.3) 
  • PFAM:
    RNase_III (CL0539) Ribonucleas_3_3; Ribonuclease-III-like (PF14622; HMM-score: 124.2)
    Ribonuclease_3; Ribonuclease III domain (PF00636; HMM-score: 78.7)
    DSRM (CL0196) dsrm; Double-stranded RNA binding motif (PF00035; HMM-score: 60.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: Mg2+
  • effectors:
  • protein partners:
    NWMN_1605(ackA)acetate kinase  [1] (data from MRSA252)
    NWMN_0372(ahpC)alkyl hydroperoxide reductase subunit C  [1] (data from MRSA252)
    NWMN_0515(capD)polysaccharide biosynthesis protein CapD  [1] (data from MRSA252)
    NWMN_1313(cspA)major cold-shock protein CspA  [1] (data from MRSA252)
    NWMN_1483(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    NWMN_0745(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    NWMN_0509(fus)elongation factor G  [1] (data from MRSA252)
    NWMN_0741(gapA)glyceraldehyde 3-phosphate dehydrogenase 1  [1] (data from MRSA252)
    NWMN_2056(glmS)glucosamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    NWMN_2315(gpmA)phosphoglyceromutase  [1] (data from MRSA252)
    NWMN_0380(guaB)inosine-5'-monophosphate dehydrogenase  [1] (data from MRSA252)
    NWMN_1178(infB)translation initiation factor IF-2  [1] (data from MRSA252)
    NWMN_0132(ipdC)indole-3-pyruvate decarboxylase  [1] (data from MRSA252)
    NWMN_0176(ldh1)L-lactate dehydrogenase  [1] (data from MRSA252)
    NWMN_0162(pflB)formate acetyltransferase  [1] (data from MRSA252)
    NWMN_0833(pgi)glucose-6-phosphate isomerase  [1] (data from MRSA252)
    NWMN_1592(pykA)pyruvate kinase  [1] (data from MRSA252)
    NWMN_2140(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    NWMN_2137(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    NWMN_0501(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    NWMN_2133(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    NWMN_1151(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    NWMN_2150(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    NWMN_1613(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    NWMN_2135(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    NWMN_2119(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    NWMN_2127(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    NWMN_2143(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    NWMN_1576(thrS)threonyl-tRNA synthetase  [1] (data from MRSA252)
    NWMN_1569(tig)trigger factor  [1] (data from MRSA252)
    NWMN_1167(tsf)elongation factor Ts  [1] (data from MRSA252)
    NWMN_0510(tufA)elongation factor Tu  [1] (data from MRSA252)
    NWMN_0475cysteine synthase-like protein  [1] (data from MRSA252)
    NWMN_0481pyridoxal biosynthesis lyase PdxS  [1] (data from MRSA252)
    NWMN_0776glycine cleavage system protein H  [1] (data from MRSA252)
    NWMN_0811hypothetical protein  [1] (data from MRSA252)
    NWMN_0949phosphocarrier protein HPr  [1] (data from MRSA252)
    NWMN_1263aconitate hydratase  [1] (data from MRSA252)
    NWMN_1604universal stress protein family protein  [1] (data from MRSA252)
    NWMN_1672putative translaldolase  [1] (data from MRSA252)
    NWMN_2086alkaline shock protein 23  [1] (data from MRSA252)
    NWMN_24541-pyrroline-5-carboxylate dehydrogenase  [1] (data from MRSA252)
    NWMN_2504malate:quinone oxidoreductase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.182
    • Ymax_pos: 11
    • Cmax: 0.136
    • Cmax_pos: 40
    • Smax: 0.375
    • Smax_pos: 1
    • Smean: 0.319
    • D: 0.235
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MSKQKKSEIVNRFRKRFDTKMTELGFTYQNIDLYQQAFSHSSFINDFNMNRLDHNERLEFLGDAVLELTVSRYLFDKHPNLPEGNLTKMRATIVCEPSLVIFANKIGLNEMILLGKGEEKTGGRTRPSLISDAFEAFIGALYLDQGLDIVWKFAEKVIFPHVEQNELLGVVDFKTQFQEYVHQQNKGDVTYNLIKEEGPAHHRLFTSEVILQGEAIAEGKGKTKKESEQRAAESAYKQLKQIK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]