From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1076 [new locus tag: SA_RS06100 ]
  • pan locus tag?: SAUPAN003520000
  • symbol: rnc
  • pan gene symbol?: rnc
  • synonym:
  • product: ribonuclease III

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1076 [new locus tag: SA_RS06100 ]
  • symbol: rnc
  • product: ribonuclease III
  • replicon: chromosome
  • strand: +
  • coordinates: 1216267..1216998
  • length: 732
  • essential: yes DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGTCTAAACAAAAGAAAAGTGAGATAGTTAATCGTTTTAGAAAGCGCTTTGATACTAAA
    ATGACAGAGTTAGGCTTTACTTATCAAAATATTGATTTATACCAACAAGCATTTTCGCAT
    TCGAGTTTTATTAATGATTTTAATATGAATCGTTTAGACCATAATGAGCGTTTAGAGTTT
    TTGGGTGATGCGGTATTAGAATTGACGGTTTCACGATATTTATTTGATAAACATCCCAAC
    TTGCCAGAAGGGAATTTAACAAAAATGCGTGCCACTATTGTATGTGAGCCCTCACTTGTA
    ATATTTGCGAATAAAATTGGATTGAACGAAATGATTTTACTTGGTAAAGGTGAAGAGAAA
    ACAGGGGGACGTACAAGACCATCATTAATATCAGATGCATTCGAAGCATTTATTGGGGCA
    TTGTATTTGGATCAAGGACTAGATATAGTTTGGAAATTTGCTGAGAAAGTTATTTTCCCA
    CATGTAGAACAAAATGAGTTATTAGGCGTGGTAGATTTTAAAACACAATTCCAAGAATAT
    GTGCACCAGCAAAATAAAGGTGATGTAACCTATAATTTAATAAAAGAAGAGGGACCGGCA
    CATCATCGTCTATTCACTTCAGAAGTTATTCTGCAAGGGGAAGCAATAGCTGAAGGTAAA
    GGGAAAACGAAAAAAGAATCAGAACAACGTGCTGCTGAAAGTGCCTATAAGCAATTAAAA
    CAAATTAAATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    732

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1076 [new locus tag: SA_RS06100 ]
  • symbol: Rnc
  • description: ribonuclease III
  • length: 243
  • theoretical pI: 7.23578
  • theoretical MW: 27921.6
  • GRAVY: -0.493416

Function[edit source | edit]

  • reaction:
    EC 3.1.26.3?  ExPASy
    Ribonuclease IIIEndonucleolytic cleavage to 5'-phosphomonoester
  • TIGRFAM:
    Genetic information processingTranscriptionRNA processingribonuclease III (TIGR02191; EC 3.1.26.3; HMM-score: 266.4)
    seadornavirus double-stranded RNA-binding protein (TIGR04238; HMM-score: 17.2)
  • TheSEED:  
    Cell Division and Cell CycleCell Division and Cell Cycle - no subcategoryTwo cell division clusters relating to chromosome partitioning Ribonuclease III (EC 3.1.26.3) 
    RNA MetabolismRNA processing and modificationRNA processing and degradation, bacterial Ribonuclease III (EC 3.1.26.3) 
    CBSS-176299.4.peg.1292 Ribonuclease III (EC 3.1.26.3) 
    COG1399 Ribonuclease III (EC 3.1.26.3) 
  • PFAM:
    RNase_III (CL0539) Ribonucleas_3_3; Ribonuclease-III-like (PF14622; HMM-score: 124.2)
    Ribonuclease_3; Ribonuclease III domain (PF00636; HMM-score: 78.7)
    DSRM (CL0196) dsrm; Double-stranded RNA binding motif (PF00035; HMM-score: 60.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: Mg2+
  • effectors:
  • protein partners:
    SA1533(ackA)acetate kinase  [1] (data from MRSA252)
    SA0366(ahpC)alkyl hydroperoxide reductase  [1] (data from MRSA252)
    SA1984(asp23)alkaline shock protein 23  [1] (data from MRSA252)
    SA1184(citB)aconitate hydratase  [1] (data from MRSA252)
    SA1234(cspA)cold-shock protein CspA  [1] (data from MRSA252)
    SA0471(cysK)hypothetical protein  [1] (data from MRSA252)
    SA1409(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    SA0731(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    SA0505(fus)elongation factor G  [1] (data from MRSA252)
    SA0727(gap)glyceraldehyde-3-phosphate dehydrogenase  [1] (data from MRSA252)
    SA1959(glmS)glucosamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    SA2204(gpmA)phosphoglyceromutase  [1] (data from MRSA252)
    SA0375(guaB)inositol-monophosphate dehydrogenase  [1] (data from MRSA252)
    SA1112(infB)translation initiation factor IF-2  [1] (data from MRSA252)
    SA0232(lctE)L-lactate dehydrogenase  [1] (data from MRSA252)
    SA2400(mqo2)malate:quinone oxidoreductase  [1] (data from MRSA252)
    SA0218(pflB)formate acetyltransferase  [1] (data from MRSA252)
    SA0823(pgi)glucose-6-phosphate isomerase  [1] (data from MRSA252)
    SA0934(ptsH)phosphocarrier protein HPr  [1] (data from MRSA252)
    SA1520(pykA)pyruvate kinase  [1] (data from MRSA252)
    SA2341(rocA)1-pyrroline-5-carboxylate dehydrogenase  [1] (data from MRSA252)
    SA2035(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    SA2033(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    SA0497(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    SA2029(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    SA1084(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    SA2045(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    SAS052(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    SA2031(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SA2016(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    SA2024(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    SA2038(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    SA1506(thrS)threonyl-tRNA synthetase  [1] (data from MRSA252)
    SA1499(tig)trigger factor  [1] (data from MRSA252)
    SA1100(tsf)elongation factor Ts  [1] (data from MRSA252)
    SA0506(tuf)elongation factor Tu  [1] (data from MRSA252)
    SA0182hypothetical protein  [1] (data from MRSA252)
    SA0477pyridoxal biosynthesis lyase PdxS  [1] (data from MRSA252)
    SA0511hypothetical protein  [1] (data from MRSA252)
    SA0760glycine cleavage system protein H  [1] (data from MRSA252)
    SA0802hypothetical protein  [1] (data from MRSA252)
    SA1532hypothetical protein  [1] (data from MRSA252)
    SA1599translaldolase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.182
    • Ymax_pos: 11
    • Cmax: 0.136
    • Cmax_pos: 40
    • Smax: 0.375
    • Smax_pos: 1
    • Smean: 0.319
    • D: 0.235
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MSKQKKSEIVNRFRKRFDTKMTELGFTYQNIDLYQQAFSHSSFINDFNMNRLDHNERLEFLGDAVLELTVSRYLFDKHPNLPEGNLTKMRATIVCEPSLVIFANKIGLNEMILLGKGEEKTGGRTRPSLISDAFEAFIGALYLDQGLDIVWKFAEKVIFPHVEQNELLGVVDFKTQFQEYVHQQNKGDVTYNLIKEEGPAHHRLFTSEVILQGEAIAEGKGKTKKESEQRAAESAYKQLKQIK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]

Eric Huntzinger, Sandrine Boisset, Cosmin Saveanu, Yvonne Benito, Thomas Geissmann, Abdelkader Namane, Gérard Lina, Jerome Etienne, Bernard Ehresmann, Chantal Ehresmann, Alain Jacquier, François Vandenesch, Pascale Romby
Staphylococcus aureus RNAIII and the endoribonuclease III coordinately regulate spa gene expression.
EMBO J.: 2005, 24(4);824-35
[PubMed:15678100] [WorldCat.org] [DOI] (P p)