From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1851 [new locus tag: SA_RS10625 ]
  • pan locus tag?: SAUPAN005291000
  • symbol: SA1851
  • pan gene symbol?: rex
  • synonym:
  • product: redox-sensing transcriptional repressor Rex

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1851 [new locus tag: SA_RS10625 ]
  • symbol: SA1851
  • product: redox-sensing transcriptional repressor Rex
  • replicon: chromosome
  • strand: -
  • coordinates: 2089419..2090054
  • length: 636
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGAGTGACCAAGTTAAAATTCCTCGAGCAACTTTAAAACGTTTGCCGTTATATTATAGA
    TTTGTCAGTTCATTAAAATCTAAAGGTATAGATCGTGTAAATTCAAAAGCGATTAGCGAT
    GCGTTACAAATTGACTCGGCAACAATTCGTCGTGACTTTTCATATTTTGGCGAATTAGGT
    AAAAAAGGGTACGGATATAATATAGATAGTTTATTGGATTTCTTTAAATCTGAACTAAGC
    GAGAGTGACATGATCAAAATCGCAATTGTCGGAGTTGGGAACCTAGGGAAAGCTTTGCTC
    ACATATAACTTTTCAATACATGACGATATGACGATTACAGAAGCGTTTGACGTAAAAGAA
    GATGTTATTGGCCAGAAAATAGGGAACGTTATTGTAAAAGATAACGATGAATTAATAACA
    ACATTGAAGAAGGAAGAAATAGATGTTGTGATTCTAACTACACCAGAAAGAGTTGCACAG
    AAAGTTGCAGATGAACTCGTCCAAGCTGGTGTGAAAGGTATTTTAAACTTCACTCCTGGT
    AGAATTAATACGCCTTCAGATGTGCAAGTACATCAAATTGACTTAGGTATAGAATTACAG
    TCATTATTATTCTTTATGAAAAATTACAGTGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    636

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1851 [new locus tag: SA_RS10625 ]
  • symbol: SA1851
  • description: redox-sensing transcriptional repressor Rex
  • length: 211
  • theoretical pI: 5.12384
  • theoretical MW: 23598.9
  • GRAVY: -0.0995261

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    diaminopimelate dehydrogenase (TIGR01921; EC 1.4.1.16; HMM-score: 21.3)
    MetabolismAmino acid biosynthesisGlutamate familyN-acetyl-gamma-glutamyl-phosphate reductase (TIGR01850; EC 1.2.1.38; HMM-score: 19.5)
    MetabolismAmino acid biosynthesisAspartate family4-hydroxy-tetrahydrodipicolinate reductase (TIGR00036; EC 1.17.1.8; HMM-score: 17.4)
    MetabolismEnergy metabolismSugarsinositol 2-dehydrogenase (TIGR04380; EC 1.1.1.18; HMM-score: 17.3)
    sugar O-acyltransferase, sialic acid O-acetyltransferase NeuD family (TIGR03570; HMM-score: 15.8)
    MetabolismAmino acid biosynthesisGlutamate familypyrroline-5-carboxylate reductase (TIGR00112; EC 1.5.1.2; HMM-score: 14.8)
    acetaldehyde dehydrogenase (acetylating) (TIGR03215; EC 1.2.1.10; HMM-score: 14.2)
    acetyl coenzyme A synthetase (ADP forming), alpha domain (TIGR02717; EC 6.2.1.13; HMM-score: 14.1)
    undecaprenyl-phosphate glucose phosphotransferase (TIGR03023; EC 2.7.8.-; HMM-score: 13.7)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidescellulose synthase operon protein YhjU (TIGR03368; HMM-score: 12.2)
    exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase (TIGR03025; HMM-score: 12)
  • TheSEED:  
    Oxidative stress Redox-sensing transcriptional repressor Rex 
  • PFAM:
    NADP_Rossmann (CL0063) CoA_binding; CoA binding domain (PF02629; HMM-score: 91.4)
    HTH (CL0123) Put_DNA-bind_N; Putative DNA-binding protein N-terminus (PF06971; HMM-score: 68.1)
    NADP_Rossmann (CL0063) Semialdhyde_dh; Semialdehyde dehydrogenase, NAD binding domain (PF01118; HMM-score: 25.3)
    GFO_IDH_MocA; Oxidoreductase family, NAD-binding Rossmann fold (PF01408; HMM-score: 19.2)
    F420_oxidored; NADP oxidoreductase coenzyme F420-dependent (PF03807; HMM-score: 18.1)
    HTH (CL0123) HTH_DeoR; DeoR-like helix-turn-helix domain (PF08220; HMM-score: 16.4)
    no clan definedPackaging_FI; DNA packaging protein FI (PF14000; HMM-score: 15.3)
    NADP_Rossmann (CL0063) CoA_binding_2; CoA binding domain (PF13380; HMM-score: 15.1)
    PreATP-grasp (CL0483) GARS_N; Phosphoribosylglycinamide synthetase, N domain (PF02844; HMM-score: 14.7)
    P-loop_NTPase (CL0023) NB-ARC; NB-ARC domain (PF00931; HMM-score: 13)
    no clan definedMTD; methylene-5,6,7,8-tetrahydromethanopterin dehydrogenase (PF01993; HMM-score: 12.2)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.16
    • Ymax_pos: 38
    • Cmax: 0.133
    • Cmax_pos: 38
    • Smax: 0.311
    • Smax_pos: 2
    • Smean: 0.196
    • D: 0.174
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MSDQVKIPRATLKRLPLYYRFVSSLKSKGIDRVNSKAISDALQIDSATIRRDFSYFGELGKKGYGYNIDSLLDFFKSELSESDMIKIAIVGVGNLGKALLTYNFSIHDDMTITEAFDVKEDVIGQKIGNVIVKDNDELITTLKKEEIDVVILTTPERVAQKVADELVQAGVKGILNFTPGRINTPSDVQVHQIDLGIELQSLLFFMKNYSE

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]

Martin Pagels, Stephan Fuchs, Jan Pané-Farré, Christian Kohler, Leonhard Menschner, Michael Hecker, Peter J McNamarra, Mikael C Bauer, Claes von Wachenfeldt, Manuel Liebeke, Michael Lalk, Gunnar Sander, Christof von Eiff, Richard A Proctor, Susanne Engelmann
Redox sensing by a Rex-family repressor is involved in the regulation of anaerobic gene expression in Staphylococcus aureus.
Mol. Microbiol.: 2010, 76(5);1142-61
[PubMed:20374494] [WorldCat.org] [DOI] (I p)