From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA2057 [new locus tag: SA_RS11830 ]
  • pan locus tag?: SAUPAN005718000
  • symbol: fmhB
  • pan gene symbol?: fmhB
  • synonym:
  • product: FmhB protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA2057 [new locus tag: SA_RS11830 ]
  • symbol: fmhB
  • product: FmhB protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2321156..2322421
  • length: 1266
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    ATGGAAAAGATGCATATCACTAATCAGGAACATGACGCATTTGTTAAATCTCACCCAAAT
    GGAGATTTATTACAATTAACGAAATGGGCAGAAACAAAGAAATTAACTGGATGGTACGCG
    CGAAGAATCGCTGTAGGTCGTGACGGTGAAGTTCAGGGTGTTGCGCAATTACTTTTTAAA
    AAAGTACCTAAATTACCGTATACGCTATGTTATATTTCACGTGGTTTTGTTGTTGATTAT
    AGTAATAAAGAAGCGTTAAATGCATTGTTAGACAGTGCAAAAGAAATTGCTAAAGCTGAG
    AAAGCGTATGCAATTAAAATCGATCCTGATGTTGAAGTTGATAAAGGTACAGATGCTTTG
    CAAAATTTGAAAGCGCTTGGTTTTAAACATAAAGGATTTAAAGAAGGTTTATCAAAAGAC
    TACATCCAACCACGTATGACTATGATTACACCAATTGATAAAAATGATGATGAGTTATTA
    AATAGTTTTGAACGCCGAAATCGTTCAAAAGTGCGCTTGGCTTTAAAGCGAGGTACGACA
    GTAGAACGATCTGATAGAGAAGGTTTAAAAACATTTGCTGAATTAATGAAAATCACTGGG
    GAACGCGATGGCTTCTTAACGCGTGATATTAGTTACTTTGAAAATATTTATGATGCGTTG
    CATGAAGATGGAGATGCTGAACTATTTTTAGTAAAGTTGGACCCAAAAGAAAATATAGCG
    AAAGTAAATCAAGAATTGAATGAACTTCATGCCGAAATAGCTAAATGGCAGCAGAAGATG
    GAAACATCTGAAAAGCAAGCTAAAAAAGCGCAAAATATGATTAATGATGCGCAAAATAAA
    ATTGCTAAAAATGAAGATTTAAAACGAGACCTAGAAGCTTTAGAAAAGGAACATCCTGAA
    GGTATTTATCTTTCTGGTGCACTATTAATGTTTGCTGGCTCAAAATCATATTACTTATAT
    GGTGCGTCTTCTAATGAATTTAGAGATTTTTTACCAAATCACCATATGCAGTATACGATG
    ATGAAGTATGCACGTGAACATGGTGCAACAACTTACGATTTCGGTGGTACAGATAATGAT
    CCAGATAAAGACTCTGAACATTATGGCTTATGGGCATTTAAAAAAGTGTGGGGAACATAC
    TTAAGTGAAAAGATTGGTGAATTTGATTATATATTGAATCAGCCATTGTACCAATTAATT
    GAGCAAGTTAAACCGCGTTTAACAAAAGCTAAAATTAAAATATCTCGTAAATTAAAACGA
    AAATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1266

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA2057 [new locus tag: SA_RS11830 ]
  • symbol: FmhB
  • description: FmhB protein
  • length: 421
  • theoretical pI: 9.06529
  • theoretical MW: 48536
  • GRAVY: -0.72114

Function[edit source | edit]

  • reaction:
    EC 2.3.2.16?  ExPASy
    Lipid II:glycine glycyltransferaseMurNAc-L-Ala-D-isoglutaminyl-L-Lys-D-Ala-D-Ala-diphospho-ditrans,octacis-undecaprenyl-GlcNAc + glycyl-tRNA(Gly) = MurNAc-L-Ala-D-isoglutaminyl-L-Lys-(N6-Gly)-D-Ala-D-Ala-diphospho-ditrans,octacis-undecaprenyl-GlcNAc + tRNA(Gly)
  • TIGRFAM:
    Unknown functionGeneralFemAB-related protein, PEP-CTERM system-associated (TIGR03019; HMM-score: 57.9)
    SH3 domain protein (TIGR04211; HMM-score: 17.3)
    two transmembrane protein (TIGR04527; HMM-score: 10.3)
    CRISPR type III-A/MTUBE-associated protein Csm2 (TIGR01870; HMM-score: 8.1)
  • TheSEED:  
    tRNA-dependent amino acid transfers Lipid II:glycine glycyltransferase (EC 2.3.2.16) 
  • PFAM:
    Acetyltrans (CL0257) FemAB; FemAB family (PF02388; HMM-score: 280.7)
    Acetyltransf_6; Acetyltransferase (GNAT) domain (PF13480; HMM-score: 50.2)
    no clan definedSpc7; Spc7 kinetochore protein (PF08317; HMM-score: 17.7)
    Laminin_II; Laminin Domain II (PF06009; HMM-score: 17.3)
    P-loop_NTPase (CL0023) AAA_13; AAA domain (PF13166; HMM-score: 16.5)
    PDDEXK (CL0236) RmuC; RmuC family (PF02646; HMM-score: 16.2)
    no clan definedIncA; IncA protein (PF04156; HMM-score: 16)
    FapA; Flagellar Assembly Protein A (PF03961; HMM-score: 15.7)
    MIS13; Mis12-Mtw1 protein family (PF08202; HMM-score: 15.7)
    FtsL (CL0225) DivIC; Septum formation initiator (PF04977; HMM-score: 15)
    Tropomyosin-lke (CL0452) Tropomyosin_1; Tropomyosin like (PF12718; HMM-score: 14.3)
    no clan definedMed28; Mediator complex subunit 28 (PF11594; HMM-score: 14.2)
    TRAF_BIRC3_bd; TNF receptor-associated factor BIRC3 binding domain (PF16673; HMM-score: 13.9)
    DUF5069; Domain of unknown function (DUF5069) (PF16798; HMM-score: 13.1)
    TMPIT; TMPIT-like protein (PF07851; HMM-score: 13)
    Cep57_CLD_2; Centrosome localisation domain of PPC89 (PF14197; HMM-score: 12.7)
    TMF_TATA_bd; TATA element modulatory factor 1 TATA binding (PF12325; HMM-score: 12.3)
    HTH (CL0123) Mnd1; Mnd1 family (PF03962; HMM-score: 11.4)
    no clan definedXhlA; Haemolysin XhlA (PF10779; HMM-score: 10.9)
    Ax_dynein_light; Axonemal dynein light chain (PF10211; HMM-score: 10.8)
    DUF3987; Protein of unknown function (DUF3987) (PF13148; HMM-score: 10.3)
    ISG65-75; Invariant surface glycoprotein (PF11727; HMM-score: 10.1)
    BRE1; BRE1 E3 ubiquitin ligase (PF08647; HMM-score: 9.5)
    PCRF; PCRF domain (PF03462; HMM-score: 8.8)
    BCLiA (CL0551) Atg14; Vacuolar sorting 38 and autophagy-related subunit 14 (PF10186; HMM-score: 7.8)
    no clan definedDUF1843; Domain of unknown function (DUF1843) (PF08898; HMM-score: 7.7)
    P-loop_NTPase (CL0023) AAA_23; AAA domain (PF13476; HMM-score: 6.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA1305(hu)DNA-binding protein II  [1] (data from MRSA252)
    SA1504(infC)translation initiation factor IF-3  [1] (data from MRSA252)
    SA1324(rluB)ribosomal large subunit pseudouridine synthase B  [1] (data from MRSA252)
    SA0496(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    SA2044(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    SA2047(rplC)50S ribosomal protein L3  [1] (data from MRSA252)
    SA2046(rplD)50S ribosomal protein L4  [1] (data from MRSA252)
    SA2035(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    SA2033(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    SA2017(rplM)50S ribosomal protein L13  [1] (data from MRSA252)
    SA2037(rplN)50S ribosomal protein L14  [1] (data from MRSA252)
    SA2029(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    SA2040(rplP)50S ribosomal protein L16  [1] (data from MRSA252)
    SA2022(rplQ)50S ribosomal protein L17  [1] (data from MRSA252)
    SA2032(rplR)50S ribosomal protein L18  [1] (data from MRSA252)
    SA1084(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    SA1502(rplT)50S ribosomal protein L20  [1] (data from MRSA252)
    SA1473(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    SA2042(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    SA2045(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    SA2036(rplX)50S ribosomal protein L24  [1] (data from MRSA252)
    SA0459(rplY)50S ribosomal protein L25  [1] (data from MRSA252)
    SA2039(rpmC)50S ribosomal protein L29  [1] (data from MRSA252)
    SA1503(rpmI)50S ribosomal protein L35  [1] (data from MRSA252)
    SA2041(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    SAS052(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    SA2031(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SA0352(rpsF)30S ribosomal protein S6  [1] (data from MRSA252)
    SA0504(rpsG)30S ribosomal protein S7  [1] (data from MRSA252)
    SA2016(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    SA2048(rpsJ)30S ribosomal protein S10  [1] (data from MRSA252)
    SA2024(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    SA0503(rpsL)30S ribosomal protein S12  [1] (data from MRSA252)
    SA2025(rpsM)30S ribosomal protein S13  [1] (data from MRSA252)
    SA1116(rpsO)30S ribosomal protein S15  [1] (data from MRSA252)
    SA2038(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    SA0354(rpsR)30S ribosomal protein S18  [1] (data from MRSA252)
    SA2043(rpsS)30S ribosomal protein S19  [1] (data from MRSA252)
    SA0295hypothetical protein  [1] (data from MRSA252)
    SA0490hypothetical protein  [1] (data from MRSA252)
    SA0627hypothetical protein  [1] (data from MRSA252)
    SA0637hypothetical protein  [1] (data from MRSA252)
    SA0940hypothetical protein  [1] (data from MRSA252)
    SA1223hypothetical protein  [1] (data from MRSA252)
    SA1387hypothetical protein  [1] (data from MRSA252)
    SA1528hypothetical protein  [1] (data from MRSA252)
    SA1885hypothetical protein  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.095
    • Ymax_pos: 39
    • Cmax: 0.109
    • Cmax_pos: 33
    • Smax: 0.116
    • Smax_pos: 30
    • Smean: 0.075
    • D: 0.087
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MEKMHITNQEHDAFVKSHPNGDLLQLTKWAETKKLTGWYARRIAVGRDGEVQGVAQLLFKKVPKLPYTLCYISRGFVVDYSNKEALNALLDSAKEIAKAEKAYAIKIDPDVEVDKGTDALQNLKALGFKHKGFKEGLSKDYIQPRMTMITPIDKNDDELLNSFERRNRSKVRLALKRGTTVERSDREGLKTFAELMKITGERDGFLTRDISYFENIYDALHEDGDAELFLVKLDPKENIAKVNQELNELHAEIAKWQQKMETSEKQAKKAQNMINDAQNKIAKNEDLKRDLEALEKEHPEGIYLSGALLMFAGSKSYYLYGASSNEFRDFLPNHHMQYTMMKYAREHGATTYDFGGTDNDPDKDSEHYGLWAFKKVWGTYLSEKIGEFDYILNQPLYQLIEQVKPRLTKAKIKISRKLKRK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]