From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0818 [new locus tag: SACOL_RS04205 ]
  • pan locus tag?: SAUPAN002664000
  • symbol: prfB
  • pan gene symbol?: prfB
  • synonym:
  • product: peptide chain release factor 2

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL0818 [new locus tag: SACOL_RS04205 ]
  • symbol: prfB
  • product: peptide chain release factor 2
  • replicon: chromosome
  • strand: +
  • coordinates: join(841862..841933,841935..842972)
  • length: 1110
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    ATGGAATTATCAGAAATCAAACGAAATATAGATAAGTATAATCAAGATTTAACACAAATT
    AGGGGGTCTCTTGACTTAGAGAACAAAGAAACTAATATTCAAGAATATGAAGAAATGATG
    GCAGAACCTAATTTTTGGGATAACCAAACGAAAGCGCAAGATATTATAGATAAAAATAAT
    GCGTTAAAAGCAATAGTTAATGGTTATAAAACACTACAAGCAGAAGTAGATGACATGGAT
    GCTACTTGGGATTTATTACAAGAAGAATTTGATGAAGAAATGAAAGAAGACTTAGAGCAA
    GAGGTCATTAATTTTAAGGCTAAAGTGGATGAATACGAATTGCAATTATTATTAGATGGG
    CCTCACGATGCCAATAACGCAATTCTAGAGTTACATCCTGGTGCAGGTGGCACGGAGTCT
    CAAGATTGGGCTAATATGCTATTTAGAATGTATCAACGTTATTGTGAGAAGAAAGGCTTT
    AAAGTTGAAACTGTTGATTATCTACCTGGGGATGAAGCGGGGATTAAAAGTGTAACATTG
    CTCATCAAAGGGCATAATGCTTATGGTTATTTAAAAGCTGAAAAAGGTGTACACCGACTA
    GTACGAATTTCTCCATTTGATTCATCAGGACGTCGTCATACATCATTTGCATCATGCGAC
    GTTATTCCAGATTTTAATAATGATGAAATAGAGATTGAAATCAATCCGGATGATATTACA
    GTTGATACATTCAGAGCTTCTGGTGCAGGTGGTCAGCATATTAACAAAACTGAATCGGCA
    ATACGAATTACCCACCACCCCTCAGGTATAGTTGTTAATAACCAAAATGAACGTTCTCAA
    ATTAAAAACCGTGAAGCAGCTATGAAAATGTTAAAGTCTAAATTATATCAATTAAAATTG
    GAAGAGCAGGCACGTGAAATGGCTGAAATTCGTGGCGAACAAAAAGAAATCGGCTGGGGA
    AGCCAAATTAGATCATATGTTTTCCATCCATACTCAATGGTGAAAGATCATCGTACGAAC
    GAAGAAACAGGTAAGGTTGATGCAGTGATGGATGGAGACATTGGACCATTTATCGAATCA
    TATTTAAGACAGACAATGTCGCACGATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1110

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL0818 [new locus tag: SACOL_RS04205 ]
  • symbol: PrfB
  • description: peptide chain release factor 2
  • length: 369
  • theoretical pI: 4.57447
  • theoretical MW: 42331
  • GRAVY: -0.759079

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein synthesisTranslation factorspeptide chain release factor 2 (TIGR00020; HMM-score: 532.1)
    Genetic information processingProtein synthesisTranslation factorspeptide chain release factor 1 (TIGR00019; HMM-score: 305)
    Genetic information processingProtein synthesisTranslation factorsputative peptide chain release factor H (TIGR03072; HMM-score: 120.2)
    SH3 domain protein (TIGR04211; HMM-score: 9)
    Cellular processesCellular processesCell divisionchromosome segregation protein SMC (TIGR02169; HMM-score: 4.7)
    Genetic information processingDNA metabolismChromosome-associated proteinschromosome segregation protein SMC (TIGR02169; HMM-score: 4.7)
  • TheSEED:  
    Protein MetabolismProtein biosynthesisProgrammed frameshift Peptide chain release factor 2 
    Protein biosynthesisProgrammed frameshift programmed frameshift-containing 
    Protein biosynthesisTranslation termination factors bacterial Peptide chain release factor 2 
    CBSS-393121.3.peg.2760 Peptide chain release factor 2 
  • PFAM:
    no clan definedPCRF; PCRF domain (PF03462; HMM-score: 214.4)
    RF (CL0337) RF-1; RF-1 domain (PF00472; HMM-score: 146.2)
    no clan definedOccludin_ELL; Occludin homology domain (PF07303; HMM-score: 13.4)
    CCDC-167; Coiled-coil domain-containing protein 167 (PF15188; HMM-score: 10.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SACOL1637(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    SACOL1016(fabI)enoyl-ACP reductase  [1] (data from MRSA252)
    SACOL1199(ftsZ)cell division protein FtsZ  [1] (data from MRSA252)
    SACOL0593(fusA)elongation factor G  [1] (data from MRSA252)
    SACOL0838(gapA1)glyceraldehyde 3-phosphate dehydrogenase  [1] (data from MRSA252)
    SACOL1513(hup)DNA-binding protein HU  [1] (data from MRSA252)
    SACOL1741(icd)isocitrate dehydrogenase  [1] (data from MRSA252)
    SACOL2272(modA)molybdenum ABC transporter molybdenum-binding protein ModA  [1] (data from MRSA252)
    SACOL1102(pdhA)pyruvate dehydrogenase complex E1 component subunit alpha  [1] (data from MRSA252)
    SACOL1103(pdhB)pyruvate dehydrogenase complex E1 component subunit beta  [1] (data from MRSA252)
    SACOL1104(pdhC)branched-chain alpha-keto acid dehydrogenase E2  [1] (data from MRSA252)
    SACOL1105(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    SACOL0204(pflB)formate acetyltransferase  [1] (data from MRSA252)
    SACOL1745(pyk)pyruvate kinase  [1] (data from MRSA252)
    SACOL0584(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    SACOL2236(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    SACOL2239(rplC)50S ribosomal protein L3  [1] (data from MRSA252)
    SACOL2238(rplD)50S ribosomal protein L4  [1] (data from MRSA252)
    SACOL0585(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    SACOL0586(rplL)50S ribosomal protein L7/L12  [1] (data from MRSA252)
    SACOL2207(rplM)50S ribosomal protein L13  [1] (data from MRSA252)
    SACOL2220(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    SACOL2223(rplR)50S ribosomal protein L18  [1] (data from MRSA252)
    SACOL1257(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    SACOL1702(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    SACOL2234(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    SACOL2237(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    SACOL1274(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    SACOL2233(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    SACOL1769(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    SACOL2222(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SACOL2206(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    SACOL2214(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    SACOL1448(sucB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    SACOL0594(tuf)elongation factor Tu  [1] (data from MRSA252)
    SACOL0211acetyl-CoA acetyltransferase  [1] (data from MRSA252)
    SACOL02123-hydroxyacyl-CoA dehydrogenase  [1] (data from MRSA252)
    SACOL0731LysR family transcriptional regulator  [1] (data from MRSA252)
    SACOL0944NADH dehydrogenase  [1] (data from MRSA252)
    SACOL1759universal stress protein  [1] (data from MRSA252)
    SACOL2173alkaline shock protein 23  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 10
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.113
    • Ymax_pos: 42
    • Cmax: 0.12
    • Cmax_pos: 42
    • Smax: 0.125
    • Smax_pos: 32
    • Smean: 0.095
    • D: 0.106
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MELSEIKRNIDKYNQDLTQIRGSLDLENKETNIQEYEEMMAEPNFWDNQTKAQDIIDKNNALKAIVNGYKTLQAEVDDMDATWDLLQEEFDEEMKEDLEQEVINFKAKVDEYELQLLLDGPHDANNAILELHPGAGGTESQDWANMLFRMYQRYCEKKGFKVETVDYLPGDEAGIKSVTLLIKGHNAYGYLKAEKGVHRLVRISPFDSSGRRHTSFASCDVIPDFNNDEIEIEINPDDITVDTFRASGAGGQHINKTESAIRITHHPSGIVVNNQNERSQIKNREAAMKMLKSKLYQLKLEEQAREMAEIRGEQKEIGWGSQIRSYVFHPYSMVKDHRTNEETGKVDAVMDGDIGPFIESYLRQTMSHD

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [2] [3] [4]
    quantitative data / protein copy number per cell: 97 [5]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40

Relevant publications[edit source | edit]