From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1641 [new locus tag: SACOL_RS08370 ]
  • pan locus tag?: SAUPAN004171000
  • symbol: lepA
  • pan gene symbol?: lepA
  • synonym:
  • product: GTP-binding protein LepA

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL1641 [new locus tag: SACOL_RS08370 ]
  • symbol: lepA
  • product: GTP-binding protein LepA
  • replicon: chromosome
  • strand: -
  • coordinates: 1671897..1673720
  • length: 1824
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    ATGGATAATGAGCAACGCTTAAAAAGAAGAGAGAATATAAGGAATTTCTCGATTATAGCA
    CATATTGACCACGGAAAATCTACATTGGCTGATAGAATTTTAGAAAATACCAAATCAGTT
    GAAACAAGAGATATGCAAGATCAGTTACTAGATTCAATGGATTTAGAAAGAGAACGTGGT
    ATTACAATCAAATTAAACGCAGTACGTTTAAAGTACGAAGCTAAAGATGGAAATACTTAT
    ACATTCCATTTAATCGATACGCCTGGACACGTCGATTTTACATATGAAGTGTCACGTTCT
    TTGGCAGCTTGTGAGGGCGCGATTTTAGTAGTAGATGCGGCTCAAGGTATCGAAGCACAA
    ACATTAGCAAATGTTTATTTAGCATTAGATAATGAGTTAGAGTTATTGCCTGTTATTAAC
    AAAATTGATTTACCTGCTGCAGAACCTGAACGCGTGAAACAAGAAATTGAAGATATGATA
    GGTTTAGACCAAGACGATGTTGTTTTAGCAAGTGCTAAATCTAACATTGGAATTGAAGAG
    ATACTAGAGAAAATAGTTGAAGTTGTGCCAGCTCCAGATGGTGACCCAGAAGCACCACTA
    AAAGCGTTAATATTTGATTCTGAGTATGATCCATATAGAGGGGTAATTTCATCGATAAGA
    ATTGTGGACGGTGTTGTTAAAGCCGGAGATAAAATTCGAATGATGGCCACTGGTAAAGAG
    TTCGAAGTAACAGAAGTTGGAATTAATACACCTAAGCAGCTTCCAGTTGATGAATTAACA
    GTTGGTGATGTTGGTTATATTATTGCAAGTATTAAAAATGTTGATGATTCTAGGGTTGGT
    GACACCATCACATTAGCTAGTAGACCTGCATCAGAACCATTGCAAGGTTATAAGAAAATG
    AATCCAATGGTATATTGCGGACTGTTCCCAATAGATAACAAAAATTATAATGATTTAAGA
    GAAGCATTAGAAAAATTACAATTGAATGATGCATCATTAGAATTTGAGCCTGAATCGTCA
    CAAGCATTAGGTTTTGGTTATAGAACTGGTTTCTTAGGTATGTTACACATGGAAATAATT
    CAAGAAAGAATTGAAAGAGAATTTGGTATTGAATTAATTGCAACTGCACCATCTGTAATT
    TATCAATGTGTTTTAAGGGACGGTTCAGAAGTGACGGTTGATAACCCAGCACAAATGCCA
    GATCGTGATAAAATTGATAAAATATTTGAGCCATATGTTCGTGCAACTATGATGGTTCCA
    AATGACTATGTCGGTGCAGTAATGGAATTATGTCAACGTAAACGTGGACAATTTATAAAT
    ATGGACTATTTAGATGATATTCGTGTAAATATTGTTTATGAATTACCTTTAGCTGAAGTT
    GTATTTGATTTCTTCGATCAACTTAAATCTAATACTAAAGGATATGCATCATTTGATTAT
    GAATTCATCGAAAATAAAGAAAGTAATTTAGTCAAGATGGATATTTTATTAAATGGTGAT
    AAAGTGGATGCGCTAAGCTTCATAGTTCATAGAGATTTTGCATATGAACGTGGTAAAGCA
    TTAGTTGAAAAACTTAAAACGTTAATTCCAAGACAGCAATTTGAAGTACCTGTACAGGCT
    GCAATAGGACAAAAAATTGTAGCGCGTACAAATATTAAATCAATGGGTAAAAACGTTTTA
    GCTAAATGTTATGGCGGTGACATAAGCCGTAAACGTAAATTACTTGAAAAACAAAAAGCA
    GGTAAAGCTAAGATGAAAGCAGTTGGTAATGTTGAAATTCCACAAGATGCTTTCTTGGCT
    GTATTGAAAATGGATGATGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1824

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL1641 [new locus tag: SACOL_RS08370 ]
  • symbol: LepA
  • description: GTP-binding protein LepA
  • length: 607
  • theoretical pI: 4.59347
  • theoretical MW: 68174.6
  • GRAVY: -0.259473

Function[edit source | edit]

  • reaction:
    EC 3.6.5.n1?  ExPASy
    Elongation factor 4GTP + H2O = GDP + phosphate
  • TIGRFAM:
    Unknown functionGeneralelongation factor 4 (TIGR01393; EC 3.6.5.-; HMM-score: 1014.8)
    Cellular processesCellular processesAdaptations to atypical conditionsGTP-binding protein TypA/BipA (TIGR01394; HMM-score: 216.6)
    Genetic information processingProtein synthesisTranslation factorsGTP-binding protein TypA/BipA (TIGR01394; HMM-score: 216.6)
    Signal transductionRegulatory functionsOtherGTP-binding protein TypA/BipA (TIGR01394; HMM-score: 216.6)
    Genetic information processingProtein synthesisTranslation factorstranslation elongation factor G (TIGR00484; HMM-score: 199.5)
    Genetic information processingProtein synthesisTranslation factorstranslation elongation factor aEF-2 (TIGR00490; HMM-score: 179.8)
    Genetic information processingProtein synthesisTranslation factorspeptide chain release factor 3 (TIGR00503; HMM-score: 98.5)
    Genetic information processingProtein synthesisTranslation factorstranslation initiation factor IF-2 (TIGR00487; HMM-score: 87.1)
    Genetic information processingProtein synthesisTranslation factorstranslation elongation factor Tu (TIGR00485; HMM-score: 74.3)
    Unknown functionGeneralsmall GTP-binding protein domain (TIGR00231; HMM-score: 72)
    Genetic information processingProtein synthesisTranslation factorsselenocysteine-specific translation elongation factor (TIGR00475; HMM-score: 68.1)
    Genetic information processingProtein synthesisTranslation factorstranslation elongation factor EF-1, subunit alpha (TIGR00483; HMM-score: 56.4)
    MetabolismCentral intermediary metabolismSulfur metabolismsulfate adenylyltransferase, large subunit (TIGR02034; EC 2.7.7.4; HMM-score: 54.7)
    translation initiation factor 2, gamma subunit (TIGR03680; HMM-score: 42.8)
    Genetic information processingProtein synthesisTranslation factorstranslation initiation factor aIF-2 (TIGR00491; HMM-score: 36.9)
    Genetic information processingProtein synthesisOtherribosome-associated GTPase EngA (TIGR03594; HMM-score: 33.9)
    Genetic information processingProtein fateProtein modification and repair[FeFe] hydrogenase H-cluster maturation GTPase HydF (TIGR03918; HMM-score: 20.2)
    Unknown functionGeneralGTP-binding protein HflX (TIGR03156; HMM-score: 19.1)
    MetabolismEnergy metabolismAmino acids and aminesethanolamine utilization protein, EutP (TIGR02528; HMM-score: 18.8)
    Genetic information processingProtein synthesisOtherribosome biogenesis GTPase YqeH (TIGR03597; HMM-score: 17.2)
    Genetic information processingProtein synthesisOtherribosome biogenesis GTP-binding protein YsxC (TIGR03598; HMM-score: 16)
  • TheSEED:  
    Protein MetabolismProtein biosynthesisTranslation elongation factors bacterial Translation elongation factor LepA 
    Protein biosynthesisUniversal GTPases Translation elongation factor LepA 
    Stress ResponseHeat shockHeat shock dnaK gene cluster extended Translation elongation factor LepA 
  • PFAM:
    P-loop_NTPase (CL0023) GTP_EFTU; Elongation factor Tu GTP binding domain (PF00009; HMM-score: 181.8)
    no clan definedLepA_C; GTP-binding protein LepA C-terminus (PF06421; HMM-score: 166.3)
    EF-G_C (CL0437) EFG_C; Elongation factor G C-terminus (PF00679; HMM-score: 82.8)
    EFTPs (CL0575) GTP_EFTU_D2; Elongation factor Tu domain 2 (PF03144; HMM-score: 51.6)
    EF-G_C (CL0437) EFG_II; Elongation Factor G, domain II (PF14492; HMM-score: 25.6)
    P-loop_NTPase (CL0023) MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 23.2)
    Ras; Ras family (PF00071; HMM-score: 19.3)
    SRPRB; Signal recognition particle receptor beta subunit (PF09439; HMM-score: 16.2)
    PduV-EutP; Ethanolamine utilisation - propanediol utilisation (PF10662; HMM-score: 15.6)
    no clan definedMMR_HSR1_Xtn; C-terminal region of MMR_HSR1 domain (PF16897; HMM-score: 15.6)
    Adeno_E3_15_3; Adenovirus 15.3kD protein in E3 region (PF03307; HMM-score: 15.5)
    EF-G_C (CL0437) RF3_C; Class II release factor RF3, C-terminal domain (PF16658; HMM-score: 15.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SACOL1215(carB)carbamoyl phosphate synthase large subunit  [1] (data from MRSA252)
    SACOL0842(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    SACOL1016(fabI)enoyl-ACP reductase  [1] (data from MRSA252)
    SACOL1198(ftsA)cell division protein FtsA  [1] (data from MRSA252)
    SACOL1199(ftsZ)cell division protein FtsZ  [1] (data from MRSA252)
    SACOL0593(fusA)elongation factor G  [1] (data from MRSA252)
    SACOL1734(gapA2)glyceraldehyde 3-phosphate dehydrogenase 2  [1] (data from MRSA252)
    SACOL1960(gatB)aspartyl/glutamyl-tRNA amidotransferase subunit B  [1] (data from MRSA252)
    SACOL1513(hup)DNA-binding protein HU  [1] (data from MRSA252)
    SACOL1288(infB)translation initiation factor IF-2  [1] (data from MRSA252)
    SACOL1727(infC)translation initiation factor IF-3  [1] (data from MRSA252)
    SACOL0173(ipdC)indole-3-pyruvate decarboxylase  [1] (data from MRSA252)
    SACOL0222(ldh1)L-lactate dehydrogenase  [1] (data from MRSA252)
    SACOL2623(mqo2)malate:quinone oxidoreductase  [1] (data from MRSA252)
    SACOL1102(pdhA)pyruvate dehydrogenase complex E1 component subunit alpha  [1] (data from MRSA252)
    SACOL1103(pdhB)pyruvate dehydrogenase complex E1 component subunit beta  [1] (data from MRSA252)
    SACOL1104(pdhC)branched-chain alpha-keto acid dehydrogenase E2  [1] (data from MRSA252)
    SACOL1105(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    SACOL2128(pdp)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    SACOL0204(pflB)formate acetyltransferase  [1] (data from MRSA252)
    SACOL0544(prsA)ribose-phosphate pyrophosphokinase  [1] (data from MRSA252)
    SACOL0539(purR)pur operon repressor  [1] (data from MRSA252)
    SACOL1745(pyk)pyruvate kinase  [1] (data from MRSA252)
    SACOL1304(recA)recombinase A  [1] (data from MRSA252)
    SACOL0584(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    SACOL2236(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    SACOL2239(rplC)50S ribosomal protein L3  [1] (data from MRSA252)
    SACOL2238(rplD)50S ribosomal protein L4  [1] (data from MRSA252)
    SACOL2227(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    SACOL2224(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    SACOL0585(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    SACOL0586(rplL)50S ribosomal protein L7/L12  [1] (data from MRSA252)
    SACOL2207(rplM)50S ribosomal protein L13  [1] (data from MRSA252)
    SACOL2220(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    SACOL2232(rplP)50S ribosomal protein L16  [1] (data from MRSA252)
    SACOL2212(rplQ)50S ribosomal protein L17  [1] (data from MRSA252)
    SACOL1257(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    SACOL1725(rplT)50S ribosomal protein L20  [1] (data from MRSA252)
    SACOL1702(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    SACOL2234(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    SACOL2237(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    SACOL2112(rpmE2)50S ribosomal protein L31  [1] (data from MRSA252)
    SACOL2233(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    SACOL1769(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    SACOL2222(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SACOL2214(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    SACOL0591(rpsL)30S ribosomal protein S12  [1] (data from MRSA252)
    SACOL2215(rpsM)30S ribosomal protein S13  [1] (data from MRSA252)
    SACOL2230(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    SACOL1449(sucA)2-oxoglutarate dehydrogenase E1 component  [1] (data from MRSA252)
    SACOL1448(sucB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    SACOL0594(tuf)elongation factor Tu  [1] (data from MRSA252)
    SACOL2104(upp)uracil phosphoribosyltransferase  [1] (data from MRSA252)
    SACOL1202(ylmF)hypothetical protein  [1] (data from MRSA252)
    SACOL0731LysR family transcriptional regulator  [1] (data from MRSA252)
    SACOL0944NADH dehydrogenase  [1] (data from MRSA252)
    SACOL0973fumarylacetoacetate hydrolase  [1] (data from MRSA252)
    SACOL1753universal stress protein  [1] (data from MRSA252)
    SACOL1759universal stress protein  [1] (data from MRSA252)
    SACOL1791FtsK/SpoIIIE family protein  [1] (data from MRSA252)
    SACOL2114aldehyde dehydrogenase  [1] (data from MRSA252)
    SACOL2553pyruvate oxidase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 1.05
    • Cytoplasmic Membrane Score: 8.78
    • Cellwall Score: 0.08
    • Extracellular Score: 0.09
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.141
    • Ymax_pos: 11
    • Cmax: 0.113
    • Cmax_pos: 30
    • Smax: 0.271
    • Smax_pos: 4
    • Smean: 0.189
    • D: 0.16
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MDNEQRLKRRENIRNFSIIAHIDHGKSTLADRILENTKSVETRDMQDQLLDSMDLERERGITIKLNAVRLKYEAKDGNTYTFHLIDTPGHVDFTYEVSRSLAACEGAILVVDAAQGIEAQTLANVYLALDNELELLPVINKIDLPAAEPERVKQEIEDMIGLDQDDVVLASAKSNIGIEEILEKIVEVVPAPDGDPEAPLKALIFDSEYDPYRGVISSIRIVDGVVKAGDKIRMMATGKEFEVTEVGINTPKQLPVDELTVGDVGYIIASIKNVDDSRVGDTITLASRPASEPLQGYKKMNPMVYCGLFPIDNKNYNDLREALEKLQLNDASLEFEPESSQALGFGYRTGFLGMLHMEIIQERIEREFGIELIATAPSVIYQCVLRDGSEVTVDNPAQMPDRDKIDKIFEPYVRATMMVPNDYVGAVMELCQRKRGQFINMDYLDDIRVNIVYELPLAEVVFDFFDQLKSNTKGYASFDYEFIENKESNLVKMDILLNGDKVDALSFIVHRDFAYERGKALVEKLKTLIPRQQFEVPVQAAIGQKIVARTNIKSMGKNVLAKCYGGDISRKRKLLEKQKAGKAKMKAVGNVEIPQDAFLAVLKMDDE

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [2] [3] [4]
    quantitative data / protein copy number per cell: 188 [5]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 1.49 1.50 1.51 1.52 1.53 1.54 1.55 1.56 1.57 1.58 1.59 1.60 1.61 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  2. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  3. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J. Proteome Res.: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  4. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  5. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]