From AureoWiki
Jump to: navigation, search

NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS08900 [old locus tag: SA1579 ]
  • pan locus tag?: SAUPAN004441000
  • symbol: SA_RS08900
  • pan gene symbol?: leuS
  • synonym:
  • product: leucine--tRNA ligase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA_RS08900 [old locus tag: SA1579 ]
  • symbol: SA_RS08900
  • product: leucine--tRNA ligase
  • replicon: chromosome
  • strand: -
  • coordinates: 1816179..1818593
  • length: 2415
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002745 (1816179..1818593) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    2161
    2221
    2281
    2341
    2401
    TTGAATTACAACCACAATCAAATTGAAAAGAAATGGCAAGACTATTGGGACGAAAATAAA
    ACATTTAAAACAAATGATAACTTAGGTCAAAAGAAATTTTATGCTTTAGACATGTTTCCA
    TATCCATCAGGTGCTGGTTTACATGTTGGACATCCTGAGGGCTATACAGCAACAGATATC
    ATTTCAAGATATAAAAGGATGCAAGGTTATAATGTATTACATCCGATGGGGTGGGATGCA
    TTCGGATTACCAGCAGAGCAATATGCTTTAGACACTGGCAACGACCCACGTGAATTTACA
    AAGAAAAATATCCAAACTTTTAAACGACAAATTAAAGAATTAGGGTTCAGTTATGATTGG
    GATCGTGAAGTTAATACAACAGATCCAGAATACTATAAATGGACACAGTGGATTTTCATA
    CAGTTATATAACAAAGGTTTAGCATACGTTGATGAAGTTGCAGTTAACTGGTGTCCAGCA
    TTAGGCACTGTTTTATCTAACGAAGAAGTGATTGATGGTGTCTCTGAACGTGGTGGACAT
    CCAGTTTATCGTAAGCCGATGAAACAATGGGTACTTAAAATCACAGAATATGCAGATCAA
    TTATTAGCAGATTTAGATGATTTAGATTGGCCTGAGTCTTTAAAAGATATGCAGCGCAAT
    TGGATTGGACGTTCTGAAGGGGCCAAAGTTTCATTTGATGTAGATAATACGGAAGGAAAA
    GTAGAAGTATTTACGACTAGACCAGACACTATCTATGGTGCATCATTCTTAGTCTTAAGT
    CCTGAACATGCATTAGTTAATTCAATTACAACTGATGAATATAAAGAAAAAGTAAAAGCT
    TATCAAACAGAAGCTTCTAAAAAGTCAGATTTAGAACGTACAGATTTAGCAAAAGATAAA
    TCAGGTGTGTTTACTGGTGCATATGCAATTAATCCTTTATCTGGTGAAAAAGTACAAATT
    TGGATTGCTGATTATGTATTATCAACATATGGTACTGGAGCAATTATGGCAGTACCAGCG
    CATGATGACAGAGATTATGAATTTGCTAAAAAGTTTGATTTGCCAATCATTGAAGTCATC
    GAAGGTGGAAATGTTGAAGAAGCAGCATACACTGGTGAAGGTAAACATATTAATTCTGGT
    GAACTTGATGGTTTAGAAAATGAAGCGGCAATTACTAAAGCTATTCAATTATTAGAGCAA
    AAAGGTGCTGGCGAAAAGAAAGTTAATTACAAATTAAGAGATTGGTTATTCAGTCGTCAG
    CGTTATTGGGGCGAACCAATTCCTGTCATTCATTGGGAAGATGGAACAATGACAACTGTT
    CCTGAAGAAGAGCTACCATTGTTGTTACCTGAAACAGATGAAATCAAGCCATCAGGGACT
    GGTGAGTCTCCACTAGCTAATATTGATTCATTTGTAAATGTTGTAGATGAAAAAACAGGT
    ATGAAAGGACGTCGTGAAACAAATACAATGCCACAATGGGCAGGTAGTTGTTGGTATTAT
    TTACGTTACATCGATCCTAAAAATGAAAATATGTTAGCAGATCCTGAAAAATTAAAACAT
    TGGTTACCTGTTGATTTATATATCGGTGGAGTAGAACATGCGGTTCTTCACTTATTATAT
    GCAAGATTTTGGCATAAAGTCCTTTATGATTTGGGTATCGTACCTACTAAAGAACCTTTC
    CAAAAATTATTTAACCAAGGTATGATTTTAGGAGAAGGTAATGAGAAGATGAGTAAATCT
    AAAGGAAATGTAATCAATCCTGATGATATAGTACAGTCTCATGGTGCAGATACTTTACGT
    CTTTACGAAATGTTTATGGGACCTTTAGATGCTGCAATTGCATGGAGTGAAAAAGGATTA
    GATGGGTCTCGTCGATTCTTAGATCGCGTATGGCGTTTAATGGTAAATGAAGATGGAACA
    TTGAGTTCAAAAATTGTAACTACAAATAATAAATCTTTAGATAAAGTTTATAACCAAACT
    GTTAAAAAGGTAACAGAAGACTTTGAAACATTAGGATTTAATACTGCTATTAGTCAATTA
    ATGGTATTTATTAATGAGTGTTATAAAGTTGATGAAGTTTATAAACCTTACATTGAAGGC
    TTCGTTAAAATGTTAGCACCTATTGCACCACATATCGGTGAAGAATTATGGTCAAAATTA
    GGACATGAAGAGTCTATTACGTACCAACCTTGGCCAACTTATGACGAAGCACTACTTGTA
    GATGATGAAGTAGAAATCGTTGTTCAAGTAAATGGTAAATTGAGAGCTAAAATTAAAATT
    GCTAAAGATACATCAAAAGAAGAAATGCAAGAAATTGCCTTATCTAATGACAATGTTAAA
    GCGAGTATTGAAGGTAAAGACATCATGAAAGTCATCGCTGTTCCTCAAAAATTAGTCAAT
    ATTGTAGCTAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2160
    2220
    2280
    2340
    2400
    2415

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA_RS08900 [old locus tag: SA1579 ]
  • symbol: SA_RS08900
  • description: leucine--tRNA ligase
  • length: 804
  • theoretical pI: 4.78881
  • theoretical MW: 91670.1
  • GRAVY: -0.500124

Function[edit source | edit]

  • reaction:
    EC 6.1.1.4?  ExPASy
    Leucine--tRNA ligaseATP + L-leucine + tRNA(Leu) = AMP + diphosphate + L-leucyl-tRNA(Leu)
  • TIGRFAM:
    Genetic information processingProtein synthesistRNA aminoacylationleucine--tRNA ligase (TIGR00396; EC 6.1.1.4; HMM-score: 1191.6)
    and 6 more
    Genetic information processingProtein synthesistRNA aminoacylationvaline--tRNA ligase (TIGR00422; EC 6.1.1.9; HMM-score: 311.1)
    Genetic information processingProtein synthesistRNA aminoacylationisoleucine--tRNA ligase (TIGR00392; EC 6.1.1.5; HMM-score: 228.8)
    Genetic information processingProtein synthesistRNA aminoacylationleucine--tRNA ligase (TIGR00395; EC 6.1.1.4; HMM-score: 226.7)
    Genetic information processingProtein synthesistRNA aminoacylationmethionine--tRNA ligase (TIGR00398; EC 6.1.1.10; HMM-score: 114.6)
    Genetic information processingProtein synthesistRNA aminoacylationcysteine--tRNA ligase (TIGR00435; EC 6.1.1.16; HMM-score: 37.3)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersGlutathione and analogscysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase (TIGR03447; EC 6.3.1.13; HMM-score: 26)
  • TheSEED:
  • PFAM:
    HUP (CL0039) tRNA-synt_1; tRNA synthetases class I (I, L, M and V) (PF00133; HMM-score: 246.8)
    tRNA-synt_1_2; Leucyl-tRNA synthetase, Domain 2 (PF13603; HMM-score: 228)
    and 5 more
    tRNA-synt_1g; tRNA synthetases class I (M) (PF09334; HMM-score: 97)
    DALR (CL0258) Anticodon_1; Anticodon-binding domain of tRNA (PF08264; HMM-score: 82.7)
    HUP (CL0039) tRNA-synt_1e; tRNA synthetases class I (C) catalytic domain (PF01406; HMM-score: 25.7)
    tRNA-synt_1f; tRNA synthetases class I (K) (PF01921; HMM-score: 18.3)
    tRNA-synt_1c; tRNA synthetases class I (E and Q), catalytic domain (PF00749; HMM-score: 12.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA_RS11130(deoA)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    SA_RS0021550S ribosomal protein L9  [1] (data from MRSA252)
    SA_RS01275formate acetyltransferase  [1] (data from MRSA252)
    SA_RS01365L-lactate dehydrogenase  [1] (data from MRSA252)
    SA_RS02095alkyl hydroperoxide reductase subunit C  [1] (data from MRSA252)
    SA_RS02145IMP dehydrogenase  [1] (data from MRSA252)
    SA_RS0291550S ribosomal protein L10  [1] (data from MRSA252)
    SA_RS0292050S ribosomal protein L7/L12  [1] (data from MRSA252)
    SA_RS02930DNA-directed RNA polymerase subunit beta  [1] (data from MRSA252)
    SA_RS02955elongation factor G  [1] (data from MRSA252)
    SA_RS02960elongation factor Tu  [1] (data from MRSA252)
    SA_RS03545hypothetical protein  [1] (data from MRSA252)
    SA_RS03665MarR family transcriptional regulator  [1] (data from MRSA252)
    SA_RS03910ribonucleotide-diphosphate reductase subunit alpha  [1] (data from MRSA252)
    SA_RS03915ribonucleotide-diphosphate reductase subunit beta  [1] (data from MRSA252)
    SA_RS04140aldehyde dehydrogenase  [1] (data from MRSA252)
    SA_RS04145phosphoglycerate kinase  [1] (data from MRSA252)
    SA_RS041552,3-bisphosphoglycerate-independent phosphoglycerate mutase  [1] (data from MRSA252)
    SA_RS04160enolase  [1] (data from MRSA252)
    SA_RS04330glycine cleavage system protein H  [1] (data from MRSA252)
    SA_RS04575NADH dehydrogenase  [1] (data from MRSA252)
    SA_RS04660NAD-specific glutamate dehydrogenase  [1] (data from MRSA252)
    SA_RS04680glucose-6-phosphate isomerase  [1] (data from MRSA252)
    SA_RS05295phosphocarrier protein HPr  [1] (data from MRSA252)
    SA_RS05860cell division protein FtsZ  [1] (data from MRSA252)
    SA_RS06085beta-ketoacyl-ACP reductase  [1] (data from MRSA252)
    SA_RS0614050S ribosomal protein L19  [1] (data from MRSA252)
    SA_RS0622530S ribosomal protein S2  [1] (data from MRSA252)
    SA_RS06235elongation factor Ts  [1] (data from MRSA252)
    SA_RS06320polyribonucleotide nucleotidyltransferase  [1] (data from MRSA252)
    SA_RS07605phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)  [1] (data from MRSA252)
    SA_RS07880glycine--tRNA ligase  [1] (data from MRSA252)
    SA_RS07955molecular chaperone DnaK  [1] (data from MRSA252)
    SA_RS0829550S ribosomal protein L21  [1] (data from MRSA252)
    SA_RS08435trigger factor  [1] (data from MRSA252)
    SA_RS08545isocitrate dehydrogenase (NADP(+))  [1] (data from MRSA252)
    SA_RS08560pyruvate kinase  [1] (data from MRSA252)
    SA_RS08630acetate kinase  [1] (data from MRSA252)
    SA_RS08760formate--tetrahydrofolate ligase  [1] (data from MRSA252)
    SA_RS09005transaldolase  [1] (data from MRSA252)
    SA_RS09775methionine aminopeptidase  [1] (data from MRSA252)
    SA_RS09810non-heme ferritin  [1] (data from MRSA252)
    SA_RS11145purine-nucleoside phosphorylase  [1] (data from MRSA252)
    SA_RS11245glutamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    SA_RS11430Asp23/Gls24 family envelope stress response protein  [1] (data from MRSA252)
    SA_RS1160030S ribosomal protein S9  [1] (data from MRSA252)
    SA_RS1163050S ribosomal protein L17  [1] (data from MRSA252)
    SA_RS1168030S ribosomal protein S5  [1] (data from MRSA252)
    SA_RS1169050S ribosomal protein L6  [1] (data from MRSA252)
    SA_RS1173530S ribosomal protein S3  [1] (data from MRSA252)
    SA_RS1174530S ribosomal protein S19  [1] (data from MRSA252)
    SA_RS1175550S ribosomal protein L23  [1] (data from MRSA252)
    SA_RS13730class I fructose-bisphosphate aldolase  [1] (data from MRSA252)
    SA_RS13735malate:quinone oxidoreductase  [1] (data from MRSA252)
    SA_RS13915ornithine carbamoyltransferase  [1] (data from MRSA252)
    SA_RS13920arginine deiminase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.111
    • Ymax_pos: 56
    • Cmax: 0.103
    • Cmax_pos: 58
    • Smax: 0.178
    • Smax_pos: 45
    • Smean: 0.097
    • D: 0.106
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 447031474 NCBI
  • RefSeq: WP_001108730 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MNYNHNQIEKKWQDYWDENKTFKTNDNLGQKKFYALDMFPYPSGAGLHVGHPEGYTATDIISRYKRMQGYNVLHPMGWDAFGLPAEQYALDTGNDPREFTKKNIQTFKRQIKELGFSYDWDREVNTTDPEYYKWTQWIFIQLYNKGLAYVDEVAVNWCPALGTVLSNEEVIDGVSERGGHPVYRKPMKQWVLKITEYADQLLADLDDLDWPESLKDMQRNWIGRSEGAKVSFDVDNTEGKVEVFTTRPDTIYGASFLVLSPEHALVNSITTDEYKEKVKAYQTEASKKSDLERTDLAKDKSGVFTGAYAINPLSGEKVQIWIADYVLSTYGTGAIMAVPAHDDRDYEFAKKFDLPIIEVIEGGNVEEAAYTGEGKHINSGELDGLENEAAITKAIQLLEQKGAGEKKVNYKLRDWLFSRQRYWGEPIPVIHWEDGTMTTVPEEELPLLLPETDEIKPSGTGESPLANIDSFVNVVDEKTGMKGRRETNTMPQWAGSCWYYLRYIDPKNENMLADPEKLKHWLPVDLYIGGVEHAVLHLLYARFWHKVLYDLGIVPTKEPFQKLFNQGMILGEGNEKMSKSKGNVINPDDIVQSHGADTLRLYEMFMGPLDAAIAWSEKGLDGSRRFLDRVWRLMVNEDGTLSSKIVTTNNKSLDKVYNQTVKKVTEDFETLGFNTAISQLMVFINECYKVDEVYKPYIEGFVKMLAPIAPHIGEELWSKLGHEESITYQPWPTYDEALLVDDEVEIVVQVNGKLRAKIKIAKDTSKEEMQEIALSNDNVKASIEGKDIMKVIAVPQKLVNIVAK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA_RS08900 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 1.49 1.50 1.51 1.52 1.53 1.54 1.55 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]