From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_1524 [new locus tag: NWMN_RS08560 ]
  • pan locus tag?: SAUPAN004223000
  • symbol: NWMN_1524
  • pan gene symbol?: iscS
  • synonym:
  • product: aminotransferase, class V

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_1524 [new locus tag: NWMN_RS08560 ]
  • symbol: NWMN_1524
  • product: aminotransferase, class V
  • replicon: chromosome
  • strand: -
  • coordinates: 1689759..1690901
  • length: 1143
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    ATGGAAATTTATGCAGATTATGCTGCGACCACACCAGTAAAACCTGAAGTAGTAGATGCG
    ATGATGACGATTTACAATTCGCATTATGGTAATCCATCATCAATACATGCTAAGGGAAGA
    GATGCGCGTAAATATTTAGATGAGTCAAGACGTCAAATTGCACAATTACTTGGTGCAGAT
    ACACATGAAATTATATTTACGAGTGGCGCAACAGAATCGAATAATACGGCAATTAAAGGC
    ATAGTAAAAGCAAATGAACAATTGGGTAATCACATTATCACATCGAAGATTGAACATCAT
    TCTGTGTTACATGTTTTTGAACAATTAGAGCGAGAAGGTTTTGATGTAACATATCTAGAT
    GTTGATGATACAGGTGCTATTGATTTAGATCAACTTGAAGAAACAATTACAGATAAGACG
    ATTTTAGTATCTATTATGTTTGTAAATAATGAAGTTGGCACAGTGCAACAAATTTATGAT
    ATTCAAGATATTATTGCTGAGACAAATGCATATTTCCATGTTGATGCGGTTCAAGCAATT
    GGACATCTTGATGTTAAGTTTGACGAATTTGAGATCGACGCAATGAGTATTACTGCTCAT
    AAGTTTGGCGGACCAAAAGGTGTCGGTGCATTACTAGTTAAAGACCATGTTACACTAGAT
    TATCCTCAACTTGGCGGTGAACAAGAATTGAAACGCCGTGCAGGCACTGAAAATCTTGCG
    CAAATTGTTGGGATGGCTAAAGCATTACAATTAGCAGAAAAGAATCGAGACGATAACAAT
    ATTCATTTAATGAATTTAAAAGAACAATTTTTAGTTAAATTACAAGAAAGAGCGATTCCA
    TTTGAATTAAATGGTTCAATGACGGATGCTACAGGCCATATTGTAAATCTATATTTTCCG
    TTTGTTGAAGTTGAAACGATGTTAACATTGTTGGATATGGCACAAATCTATGTGTCGTCT
    GGATCTGCATGTACAGCAGGCTCTACACAACCGTCGCATGTTTTAGATGCAATGTTCGAA
    GATGAGGAGCGATCAAATCATTCGATTCGATTTAGTTTTAACGAATTGACTACTGAAAAT
    GAAATTAATGCAATTGTAGCTGAAATTCATAAAATATATTTTAAATTTAAGGAGGAGTCA
    TAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1143

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_1524 [new locus tag: NWMN_RS08560 ]
  • symbol: NWMN_1524
  • description: aminotransferase, class V
  • length: 380
  • theoretical pI: 4.53326
  • theoretical MW: 42484.5
  • GRAVY: -0.236579

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    cysteine desulfurase NifS (TIGR03402; EC 2.8.1.7; HMM-score: 431.5)
    Genetic information processingProtein synthesistRNA and rRNA base modificationcysteine desulfurase IscS (TIGR02006; EC 2.8.1.7; HMM-score: 378.7)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOthercysteine desulfurase IscS (TIGR02006; EC 2.8.1.7; HMM-score: 378.7)
    Genetic information processingDNA metabolismRestriction/modificationcysteine desulfurase DndA (TIGR03235; EC 2.8.1.7; HMM-score: 370.2)
    cysteine desulfurase, NifS family (TIGR03403; EC 2.8.1.7; HMM-score: 270.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOthercysteine desulfurase, SufS family (TIGR01979; HMM-score: 175.1)
    Unknown functionEnzymes of unknown specificitycysteine desulfurase family protein (TIGR01977; HMM-score: 157.2)
    Unknown functionEnzymes of unknown specificitycysteine desulfurase family protein (TIGR01976; HMM-score: 98)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOthercysteine desulfurase, catalytic subunit CsdA (TIGR03392; EC 2.8.1.7; HMM-score: 97.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersGlutathione and analogsergothioneine biosynthesis PLP-dependent enzyme EgtE (TIGR04343; EC 4.4.-.-; HMM-score: 69.6)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOthertyrosine decarboxylase MnfA (TIGR03812; EC 4.1.1.25; HMM-score: 51.1)
    2-aminoethylphosphonate aminotransferase (TIGR03301; EC 2.6.1.-; HMM-score: 35.6)
    Cellular processesCellular processesBiosynthesis of natural productscapreomycidine synthase (TIGR03947; HMM-score: 23.8)
    tyrosine/nicotianamine family aminotransferase (TIGR01265; HMM-score: 22.6)
    O-phospho-L-seryl-tRNA:Cys-tRNA synthase (TIGR02539; EC 2.5.1.73; HMM-score: 19.6)
    MetabolismEnergy metabolismAmino acids and aminestyrosine aminotransferase (TIGR01264; EC 2.6.1.5; HMM-score: 18.2)
    MetabolismCentral intermediary metabolismPhosphorus compounds2-aminoethylphosphonate--pyruvate transaminase (TIGR02326; EC 2.6.1.37; HMM-score: 17.3)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPantothenate and coenzyme Aputative pyridoxal-dependent aspartate 1-decarboxylase (TIGR03799; EC 4.1.1.-; HMM-score: 16.8)
    dTDP-4-dehydro-6-deoxyglucose aminotransferase (TIGR04427; EC 2.-.-.-; HMM-score: 16.8)
    MetabolismAmino acid biosynthesisHistidine familyhistidinol-phosphate transaminase (TIGR01141; EC 2.6.1.9; HMM-score: 14.9)
    putative C-S lyase (TIGR04350; EC 4.4.-.-; HMM-score: 11.6)
  • TheSEED:  
    Amino Acids and DerivativesAlanine, serine, and glycineAlanine biosynthesis Cysteine desulfurase (EC 2.8.1.7) 
    RNA MetabolismRNA processing and modificationtRNA modification Archaea Cysteine desulfurase (EC 2.8.1.7) 
    Sulfur MetabolismOrganic sulfur assimilationAt5g37530 (CsdL protein family) Cysteine desulfurase (EC 2.8.1.7) 
    CBSS-393130.3.peg.794 Cysteine desulfurase (EC 2.8.1.7) 
    CBSS-84588.1.peg.1247 Cysteine desulfurase (EC 2.8.1.7) 
  • PFAM:
    PLP_aminotran (CL0061) Aminotran_5; Aminotransferase class-V (PF00266; HMM-score: 266.7)
    DegT_DnrJ_EryC1; DegT/DnrJ/EryC1/StrS aminotransferase family (PF01041; HMM-score: 31.7)
    Cys_Met_Meta_PP; Cys/Met metabolism PLP-dependent enzyme (PF01053; HMM-score: 18.1)
    Pyridoxal_deC; Pyridoxal-dependent decarboxylase conserved domain (PF00282; HMM-score: 18)
    Beta_elim_lyase; Beta-eliminating lyase (PF01212; HMM-score: 16.3)
    no clan definedHR1; Hr1 repeat (PF02185; HMM-score: 10.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: pyridoxal 5'-phosphate
  • effectors:
  • protein partners:
    NWMN_1605(ackA)acetate kinase  [1] (data from MRSA252)
    NWMN_1483(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    NWMN_0745(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    NWMN_1096(ftsZ)cell division protein FtsZ  [1] (data from MRSA252)
    NWMN_0741(gapA)glyceraldehyde 3-phosphate dehydrogenase 1  [1] (data from MRSA252)
    NWMN_2056(glmS)glucosamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    NWMN_1217(glnA)glutamine synthetase  [1] (data from MRSA252)
    NWMN_1574(infC)translation initiation factor IF-3  [1] (data from MRSA252)
    NWMN_2499(ldh)L-lactate dehydrogenase 2  [1] (data from MRSA252)
    NWMN_2040(pdp)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    NWMN_0162(pflB)formate acetyltransferase  [1] (data from MRSA252)
    NWMN_0833(pgi)glucose-6-phosphate isomerase  [1] (data from MRSA252)
    NWMN_0742(pgk)phosphoglycerate kinase  [1] (data from MRSA252)
    NWMN_2438(poxB)pyruvate oxidase  [1] (data from MRSA252)
    NWMN_1592(pykA)pyruvate kinase  [1] (data from MRSA252)
    NWMN_0500(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    NWMN_2149(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    NWMN_2137(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    NWMN_0501(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    NWMN_0499(rplK)50S ribosomal protein L11  [1] (data from MRSA252)
    NWMN_2133(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    NWMN_1151(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    NWMN_2147(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    NWMN_1166(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    NWMN_2146(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    NWMN_1613(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    NWMN_2135(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    NWMN_2138(rpsH)30S ribosomal protein S8  [1] (data from MRSA252)
    NWMN_2119(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    NWMN_2127(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    NWMN_1182(rpsO)30S ribosomal protein S15  [1] (data from MRSA252)
    NWMN_1148(rpsP)30S ribosomal protein S16  [1] (data from MRSA252)
    NWMN_2143(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    NWMN_0055(spa)immunoglobulin G binding protein A precursor (protein A)  [1] (data from MRSA252)
    NWMN_0743(tpiA)triosephosphate isomerase  [1] (data from MRSA252)
    NWMN_0510(tufA)elongation factor Tu  [1] (data from MRSA252)
    NWMN_0481pyridoxal biosynthesis lyase PdxS  [1] (data from MRSA252)
    NWMN_0641hypothetical protein  [1] (data from MRSA252)
    NWMN_0811hypothetical protein  [1] (data from MRSA252)
    NWMN_1263aconitate hydratase  [1] (data from MRSA252)
    NWMN_1382DNA-binding protein HU  [1] (data from MRSA252)
    NWMN_1600universal stress protein family protein  [1] (data from MRSA252)
    NWMN_1604universal stress protein family protein  [1] (data from MRSA252)
    NWMN_2086alkaline shock protein 23  [1] (data from MRSA252)
    NWMN_2504malate:quinone oxidoreductase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.18
    • Ymax_pos: 38
    • Cmax: 0.266
    • Cmax_pos: 38
    • Smax: 0.175
    • Smax_pos: 20
    • Smean: 0.091
    • D: 0.145
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MEIYADYAATTPVKPEVVDAMMTIYNSHYGNPSSIHAKGRDARKYLDESRRQIAQLLGADTHEIIFTSGATESNNTAIKGIVKANEQLGNHIITSKIEHHSVLHVFEQLEREGFDVTYLDVDDTGAIDLDQLEETITDKTILVSIMFVNNEVGTVQQIYDIQDIIAETNAYFHVDAVQAIGHLDVKFDEFEIDAMSITAHKFGGPKGVGALLVKDHVTLDYPQLGGEQELKRRAGTENLAQIVGMAKALQLAEKNRDDNNIHLMNLKEQFLVKLQERAIPFELNGSMTDATGHIVNLYFPFVEVETMLTLLDMAQIYVSSGSACTAGSTQPSHVLDAMFEDEERSNHSIRFSFNELTTENEINAIVAEIHKIYFKFKEES

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]