From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0766 [new locus tag: SACOL_RS03935 ]
  • pan locus tag?: SAUPAN002591000
  • symbol: saeR
  • pan gene symbol?: saeR
  • synonym:
  • product: DNA-binding response regulator SaeR

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL0766 [new locus tag: SACOL_RS03935 ]
  • symbol: saeR
  • product: DNA-binding response regulator SaeR
  • replicon: chromosome
  • strand: -
  • coordinates: 788786..789472
  • length: 687
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGACCCACTTACTGATCGTGGATGATGAACAAGACATTGTAGACATTTGTCAAACCTAT
    TTTGAATATGAAGGTTACAAAGTAACAACGACAACTAGCGGTAAAGAAGCAATTTCTTTA
    CTATCAAATGATATTGATATCATGGTACTTGATATCATGATGCCAGAAGTTAATGGTTAC
    GACATTGTCAAAGAAATGAAAAGGCAAAAATTAGATATCCCCTTTATCTATTTAACTGCC
    AAAACACAAGAACATGATACCATTTACGCCTTAACTTTAGGTGCAGATGACTATGTCAAA
    AAACCATTTAGTCCAAGGGAACTCGTTTTACGTATTAATAATTTACTTACAAGAATGAAG
    AAATACCATCATCAACCAGTTGAACAACTGTCGTTTGATGAATTAACACTTATTAACTTA
    AGTAAAGTTGTGACTGTAAATGGTCACGAAGTCCCTATGCGTATTAAGGAATTTGAGTTA
    TTGTGGTATTTAGCTTCTAGAGAAAATGAAGTTATTTCTAAATCAGAATTACTTGAAAAA
    GTTTGGGGATATGACTATTACGAAGATGCTAATACCGTGAATGTCCATATACACCGTATT
    AGAGAAAAATTAGAAAAAGAGAGCTTTACAACATATACCATCACAACTGTATGGGGATTA
    GGATATAAATTTGAAAGGAGCCGATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    687

Protein[edit source | edit]

Protein Data Bank: 4QWQ

General[edit source | edit]

  • locus tag: SACOL0766 [new locus tag: SACOL_RS03935 ]
  • symbol: SaeR
  • description: DNA-binding response regulator SaeR
  • length: 228
  • theoretical pI: 5.0506
  • theoretical MW: 26857.6
  • GRAVY: -0.339912

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Signal transductionRegulatory functionsDNA interactionsphosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 180.9)
    Signal transductionSignal transductionTwo-component systemsphosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 180.9)
    Signal transductionRegulatory functionsDNA interactionsheavy metal response regulator (TIGR01387; HMM-score: 151.1)
    proteobacterial dedicated sortase system response regulator (TIGR03787; HMM-score: 111.6)
    Cellular processesCellular processesSporulation and germinationsporulation transcription factor Spo0A (TIGR02875; HMM-score: 67.1)
    MetabolismCentral intermediary metabolismNitrogen metabolismnitrogen regulation protein NR(I) (TIGR01818; HMM-score: 58.6)
    Signal transductionRegulatory functionsDNA interactionsnitrogen regulation protein NR(I) (TIGR01818; HMM-score: 58.6)
    Signal transductionSignal transductionTwo-component systemsnitrogen regulation protein NR(I) (TIGR01818; HMM-score: 58.6)
    Signal transductionSignal transductionTwo-component systemsTMAO reductase sytem sensor TorS (TIGR02956; EC 2.7.13.3; HMM-score: 50.6)
    Signal transductionRegulatory functionsDNA interactionsPEP-CTERM-box response regulator transcription factor (TIGR02915; HMM-score: 28.2)
  • TheSEED:  
    Response regulator SaeR (Staphylococcus exoprotein expression protein R) 
  • PFAM:
    CheY (CL0304) Response_reg; Response regulator receiver domain (PF00072; HMM-score: 101)
    HTH (CL0123) Trans_reg_C; Transcriptional regulatory protein, C terminal (PF00486; HMM-score: 90.6)
    CheY (CL0304) OKR_DC_1_N; Orn/Lys/Arg decarboxylase, N-terminal domain (PF03709; HMM-score: 22.7)
    EF_hand (CL0220) Caleosin; Caleosin related protein (PF05042; HMM-score: 13.4)
    no clan definedDUF2911; Protein of unknown function (DUF2911) (PF11138; HMM-score: 13.3)
    LMSTEN; LMSTEN motif (PF07988; HMM-score: 11.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.67
    • Cytoplasmic Membrane Score: 0.01
    • Cellwall Score: 0.15
    • Extracellular Score: 0.17
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.099
    • Ymax_pos: 70
    • Cmax: 0.11
    • Cmax_pos: 23
    • Smax: 0.118
    • Smax_pos: 65
    • Smean: 0.071
    • D: 0.088
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MTHLLIVDDEQDIVDICQTYFEYEGYKVTTTTSGKEAISLLSNDIDIMVLDIMMPEVNGYDIVKEMKRQKLDIPFIYLTAKTQEHDTIYALTLGADDYVKKPFSPRELVLRINNLLTRMKKYHHQPVEQLSFDELTLINLSKVVTVNGHEVPMRIKEFELLWYLASRENEVISKSELLEKVWGYDYYEDANTVNVHIHRIREKLEKESFTTYTITTVWGLGYKFERSR

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [1] [2] [3]
    quantitative data / protein copy number per cell: 64 [4]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: SaeR
    SaeR (TF) important in VirulenceRegPrecise    transcription unit transferred from N315 data RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J. Proteome Res.: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  3. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  4. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]

Kathrin Rogasch, Vanessa Rühmling, Jan Pané-Farré, Dirk Höper, Christin Weinberg, Stephan Fuchs, Mareike Schmudde, Barbara M Bröker, Christiane Wolz, Michael Hecker, Susanne Engelmann
Influence of the two-component system SaeRS on global gene expression in two different Staphylococcus aureus strains.
J. Bacteriol.: 2006, 188(22);7742-58
[PubMed:17079681] [WorldCat.org] [DOI] (P p)
Julia Schmitt, Insa Joost, Eric P Skaar, Mathias Herrmann, Markus Bischoff
Haemin represses the haemolytic activity of Staphylococcus aureus in an Sae-dependent manner.
Microbiology (Reading, Engl.): 2012, 158(Pt 10);2619-31
[PubMed:22859613] [WorldCat.org] [DOI] (I p)