From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0766 [new locus tag: SACOL_RS03935 ]
  • pan locus tag?: SAUPAN002591000
  • symbol: saeR
  • pan gene symbol?: saeR
  • synonym:
  • product: DNA-binding response regulator SaeR

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL0766 [new locus tag: SACOL_RS03935 ]
  • symbol: saeR
  • product: DNA-binding response regulator SaeR
  • replicon: chromosome
  • strand: -
  • coordinates: 788786..789472
  • length: 687
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGACCCACTTACTGATCGTGGATGATGAACAAGACATTGTAGACATTTGTCAAACCTAT
    TTTGAATATGAAGGTTACAAAGTAACAACGACAACTAGCGGTAAAGAAGCAATTTCTTTA
    CTATCAAATGATATTGATATCATGGTACTTGATATCATGATGCCAGAAGTTAATGGTTAC
    GACATTGTCAAAGAAATGAAAAGGCAAAAATTAGATATCCCCTTTATCTATTTAACTGCC
    AAAACACAAGAACATGATACCATTTACGCCTTAACTTTAGGTGCAGATGACTATGTCAAA
    AAACCATTTAGTCCAAGGGAACTCGTTTTACGTATTAATAATTTACTTACAAGAATGAAG
    AAATACCATCATCAACCAGTTGAACAACTGTCGTTTGATGAATTAACACTTATTAACTTA
    AGTAAAGTTGTGACTGTAAATGGTCACGAAGTCCCTATGCGTATTAAGGAATTTGAGTTA
    TTGTGGTATTTAGCTTCTAGAGAAAATGAAGTTATTTCTAAATCAGAATTACTTGAAAAA
    GTTTGGGGATATGACTATTACGAAGATGCTAATACCGTGAATGTCCATATACACCGTATT
    AGAGAAAAATTAGAAAAAGAGAGCTTTACAACATATACCATCACAACTGTATGGGGATTA
    GGATATAAATTTGAAAGGAGCCGATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    687

Protein[edit | edit source]

Protein Data Bank: 4QWQ

General[edit | edit source]

  • locus tag: SACOL0766 [new locus tag: SACOL_RS03935 ]
  • symbol: SaeR
  • description: DNA-binding response regulator SaeR
  • length: 228
  • theoretical pI: 5.0506
  • theoretical MW: 26857.6
  • GRAVY: -0.339912

Function[edit | edit source]

  • TIGRFAM:
    Signal transduction Regulatory functions DNA interactions phosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 180.9)
    Signal transduction Signal transduction Two-component systems phosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 180.9)
    Signal transduction Regulatory functions DNA interactions heavy metal response regulator (TIGR01387; HMM-score: 151.1)
    and 7 more
    proteobacterial dedicated sortase system response regulator (TIGR03787; HMM-score: 111.6)
    Cellular processes Cellular processes Sporulation and germination sporulation transcription factor Spo0A (TIGR02875; HMM-score: 67.1)
    Metabolism Central intermediary metabolism Nitrogen metabolism nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 58.6)
    Signal transduction Regulatory functions DNA interactions nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 58.6)
    Signal transduction Signal transduction Two-component systems nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 58.6)
    Signal transduction Signal transduction Two-component systems TMAO reductase sytem sensor TorS (TIGR02956; EC 2.7.13.3; HMM-score: 50.6)
    Signal transduction Regulatory functions DNA interactions PEP-CTERM-box response regulator transcription factor (TIGR02915; HMM-score: 28.2)
  • TheSEED  :
    • Response regulator SaeR (Staphylococcus exoprotein expression protein R)
  • PFAM:
    CheY (CL0304) Response_reg; Response regulator receiver domain (PF00072; HMM-score: 101)
    HTH (CL0123) Trans_reg_C; Transcriptional regulatory protein, C terminal (PF00486; HMM-score: 90.6)
    and 4 more
    CheY (CL0304) OKR_DC_1_N; Orn/Lys/Arg decarboxylase, N-terminal domain (PF03709; HMM-score: 22.7)
    EF_hand (CL0220) Caleosin; Caleosin related protein (PF05042; HMM-score: 13.4)
    no clan defined DUF2911; Protein of unknown function (DUF2911) (PF11138; HMM-score: 13.3)
    LMSTEN; LMSTEN motif (PF07988; HMM-score: 11.8)

Structure, modifications & cofactors[edit | edit source]

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.67
    • Cytoplasmic Membrane Score: 0.01
    • Cellwall Score: 0.15
    • Extracellular Score: 0.17
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.002662
    • TAT(Tat/SPI): 0.000098
    • LIPO(Sec/SPII): 0.000616
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MTHLLIVDDEQDIVDICQTYFEYEGYKVTTTTSGKEAISLLSNDIDIMVLDIMMPEVNGYDIVKEMKRQKLDIPFIYLTAKTQEHDTIYALTLGADDYVKKPFSPRELVLRINNLLTRMKKYHHQPVEQLSFDELTLINLSKVVTVNGHEVPMRIKEFELLWYLASRENEVISKSELLEKVWGYDYYEDANTVNVHIHRIREKLEKESFTTYTITTVWGLGYKFERSR

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Cytoplasmic [2] [3] [4]
  • quantitative data / protein copy number per cell: 64 [5]
  • interaction partners:

Expression & Regulation[edit | edit source]

Regulation[edit | edit source]

  • regulator: SaeR (activation) regulon
    SaeR(TF)important in Virulence; RegPrecise    transcription unit transferred from N315 data RegPrecise 

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Tobias Geiger, Christiane Goerke, Markus Mainiero, Dirk Kraus, Christiane Wolz
    The virulence regulator Sae of Staphylococcus aureus: promoter activities and response to phagocytosis-related signals.
    J Bacteriol: 2008, 190(10);3419-28
    [PubMed:18344360] [WorldCat.org] [DOI] (I p)
  2. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  3. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  4. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  5. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]

Kathrin Rogasch, Vanessa Rühmling, Jan Pané-Farré, Dirk Höper, Christin Weinberg, Stephan Fuchs, Mareike Schmudde, Barbara M Bröker, Christiane Wolz, Michael Hecker, Susanne Engelmann
Influence of the two-component system SaeRS on global gene expression in two different Staphylococcus aureus strains.
J Bacteriol: 2006, 188(22);7742-58
[PubMed:17079681] [WorldCat.org] [DOI] (P p)
Julia Schmitt, Insa Joost, Eric P Skaar, Mathias Herrmann, Markus Bischoff
Haemin represses the haemolytic activity of Staphylococcus aureus in an Sae-dependent manner.
Microbiology (Reading): 2012, 158(Pt 10);2619-2631
[PubMed:22859613] [WorldCat.org] [DOI] (I p)