From AureoWiki
Jump to: navigation, search

NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS04060 [old locus tag: SA0713 ]
  • pan locus tag?: SAUPAN002672000
  • symbol: SA_RS04060
  • pan gene symbol?: uvrB
  • synonym:
  • product: excinuclease ABC subunit B

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA_RS04060 [old locus tag: SA0713 ]
  • symbol: SA_RS04060
  • product: excinuclease ABC subunit B
  • replicon: chromosome
  • strand: +
  • coordinates: 812941..814926
  • length: 1986
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002745 (812941..814926) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    ATGGTTGAACATTATCCTTTTAAAATACATTCTGATTTTGAGCCTCAAGGTGACCAACCG
    CAAGCAATTAAGGAAATCGTGGATGGTATTAAAGCGGGGAAAAGACATCAAACTTTATTA
    GGTGCAACTGGCACAGGGAAAACATTTACGATGAGTAATGTTATTAAAGAAGTTGGGAAA
    CCAACGTTAATTATCGCACATAACAAAACATTAGCAGGGCAATTATATAGTGAGTTTAAA
    GAATTTTTTCCTGAAAACAGGGTGGAATACTTTGTAAGTTACTATGATTATTATCAACCT
    GAGGCATACGTACCGTCTACTGACACTTTTATTGAAAAAGATGCCTCAATCAATGATGAA
    ATTGATCAACTACGACATTCTGCTACAAGTGCATTATTTGAACGCGATGATGTAATTATT
    ATTGCTAGTGTAAGTTGTATATATGGTTTAGGTAATCCTGAAGAATATAAAGATTTAGTA
    GTAAGTGTTCGAGTTGGTATGGAAATGGATAGAAGTGAATTACTTAGAAAACTTGTAGAT
    GTGCAATATACACGAAATGACATCGATTTCCAACGAGGAACGTTTCGAGTGCGTGGTGAT
    GTAGTTGAAATATTCCCAGCCTCTAAAGAAGAACTTTGTATAAGGGTTGAGTTTTTCGGC
    GATGAGATTGACCGTATCCGAGAAGTTAACTACCTAACAGGTGAAGTGTTGAAAGAAAGA
    GAACATTTTGCGATATTCCCAGCTTCTCACTTCGTAACACGTGAAGAAAAGTTGAAAGTT
    GCGATTGAACGTATTGAAAAAGAATTGGAAGAACGATTGAAAGAATTACGAGATGAGAAT
    AAATTACTAGAAGCGCAAAGGTTAGAACAGCGTACCAACTATGATTTAGAAATGATGCGA
    GAGATGGGATTCTGTTCAGGAATTGAAAACTATTCCGTACATTTAACTTTGCGACCACTG
    GGTTCGACACCGTATACTTTATTGGATTACTTTGGCGATGATTGGTTAGTAATGATTGAT
    GAATCACATGTGACATTACCACAAGTTCGAGGCATGTATAACGGAGACAGAGCGCGTAAA
    CAAGTTTTGGTGGATCATGGATTTAGATTACCGAGTGCATTAGATAACCGTCCACTTAAA
    TTTGAAGAATTTGAAGAAAAGACAAAACAACTTGTGTATGTATCTGCAACGCCTGGACCA
    TACGAAATTGAACATACGGATAAGATGGTTGAACAAATTATTCGTCCTACTGGTTTACTG
    GATCCTAAAATTGAGGTTAGACCTACTGAAAATCAAATTGACGATTTATTAAGTGAAATT
    CAAACAAGGGTTGAGCGTAATGAACGCGTACTTGTTACAACGCTCACTAAAAAGATGAGT
    GAAGATTTAACCACATACATGAAAGAAGCGGGTATTAAAGTTAATTATCTGCATTCAGAA
    ATCAAGACATTAGAACGAATCGAAATAATTAGAGACTTACGAATGGGTACATATGATGTT
    ATCGTAGGTATTAATTTATTAAGAGAGGGTATTGATATACCAGAAGTTTCTCTAGTTGTC
    ATATTAGATGCAGATAAAGAAGGATTTTTACGTTCTAACCGCTCATTAATTCAAACAATA
    GGTAGAGCTGCGCGTAACGATAAAGGTGAAGTCATTATGTATGCCGATAAAATGACTGAT
    TCGATGAAGTATGCAATTGATGAGACACAACGTCGTCGAGAAATACAGATGAAACATAAT
    GAAAAACATGGTATTACACCTAAAACAATTAATAAAAAAATACATGATTTAATTAGTGCT
    ACTGTTGAAAATGACGAAAATAATGACAAAGCACAAACTGTGATACCTAAGAAGATGACG
    AAAAAAGAACGTCAAAAGACAATCGACAATATAGAAAAAGAAATGAAACAAGCAGCGAAA
    GATTTAGATTTCGAGAAAGCTACAGAATTAAGAGATATGTTATTTGAATTAAAAGCAGAA
    GGGTGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    1986

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA_RS04060 [old locus tag: SA0713 ]
  • symbol: SA_RS04060
  • description: excinuclease ABC subunit B
  • length: 661
  • theoretical pI: 5.05238
  • theoretical MW: 76633.8
  • GRAVY: -0.554614

Function[edit source | edit]

  • TIGRFAM:
    Genetic information processingDNA metabolismDNA replication, recombination, and repairexcinuclease ABC subunit B (TIGR00631; EC 3.1.25.-; HMM-score: 1109.3)
    and 8 more
    Genetic information processingDNA metabolismDNA replication, recombination, and repairtranscription-repair coupling factor (TIGR00580; EC 3.6.1.-; HMM-score: 64.5)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairATP-dependent DNA helicase RecG (TIGR00643; EC 3.6.4.12; HMM-score: 46.8)
    DNA phosphorothioation system restriction enzyme (TIGR04095; HMM-score: 39.7)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairprimosomal protein N' (TIGR00595; EC 3.6.1.-; HMM-score: 32.2)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairATP-dependent DNA helicase, RecQ family (TIGR00614; EC 3.6.4.12; HMM-score: 27.9)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairATP-dependent DNA helicase RecQ (TIGR01389; EC 3.6.4.12; HMM-score: 27.6)
    DEXH box helicase, DNA ligase-associated (TIGR04121; EC 3.6.4.-; HMM-score: 18)
    helicase/secretion neighborhood putative DEAH-box helicase (TIGR03817; HMM-score: 13.6)
  • TheSEED:
  • PFAM:
    P-loop_NTPase (CL0023) UvrB; Ultra-violet resistance protein B (PF12344; HMM-score: 84.2)
    Helicase_C; Helicase conserved C-terminal domain (PF00271; HMM-score: 73.4)
    and 14 more
    ResIII; Type III restriction enzyme, res subunit (PF04851; HMM-score: 46.1)
    no clan definedUVR; UvrB/uvrC motif (PF02151; HMM-score: 35.4)
    P-loop_NTPase (CL0023) DEAD; DEAD/DEAH box helicase (PF00270; HMM-score: 23.6)
    AAA_30; AAA domain (PF13604; HMM-score: 21.2)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 16)
    Kinesin; Kinesin motor domain (PF00225; HMM-score: 13.5)
    DUF87; Domain of unknown function DUF87 (PF01935; HMM-score: 13.2)
    AAA_19; AAA domain (PF13245; HMM-score: 12.8)
    MEDS; MEDS: MEthanogen/methylotroph, DcmR Sensory domain (PF14417; HMM-score: 12.8)
    TrwB_AAD_bind; Type IV secretion-system coupling protein DNA-binding domain (PF10412; HMM-score: 12.2)
    DUF853; Bacterial protein of unknown function (DUF853) (PF05872; HMM-score: 12.1)
    AAA_25; AAA domain (PF13481; HMM-score: 11.1)
    PDDEXK (CL0236) Sen15; Sen15 protein (PF09631; HMM-score: 10.7)
    Oxa1 (CL0376) DUF106; Integral membrane protein DUF106 (PF01956; HMM-score: 9.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA_RS00690immunoglobulin G-binding protein A  [1] (data from MRSA252)
    SA_RS01275formate acetyltransferase  [1] (data from MRSA252)
    SA_RS01365L-lactate dehydrogenase  [1] (data from MRSA252)
    SA_RS0202530S ribosomal protein S18  [1] (data from MRSA252)
    SA_RS02095alkyl hydroperoxide reductase subunit C  [1] (data from MRSA252)
    SA_RS02145IMP dehydrogenase  [1] (data from MRSA252)
    SA_RS02490YbaB/EbfC family nucleoid-associated protein  [1] (data from MRSA252)
    SA_RS02710cysteine synthase  [1] (data from MRSA252)
    SA_RS0291550S ribosomal protein L10  [1] (data from MRSA252)
    SA_RS0292050S ribosomal protein L7/L12  [1] (data from MRSA252)
    SA_RS02935DNA-directed RNA polymerase subunit beta'  [1] (data from MRSA252)
    SA_RS0295030S ribosomal protein S7  [1] (data from MRSA252)
    SA_RS02955elongation factor G  [1] (data from MRSA252)
    SA_RS02960elongation factor Tu  [1] (data from MRSA252)
    SA_RS03155phosphate acetyltransferase  [1] (data from MRSA252)
    SA_RS04065excinuclease ABC subunit A  [1] (data from MRSA252)
    SA_RS04140aldehyde dehydrogenase  [1] (data from MRSA252)
    SA_RS04150triose-phosphate isomerase  [1] (data from MRSA252)
    SA_RS041552,3-bisphosphoglycerate-independent phosphoglycerate mutase  [1] (data from MRSA252)
    SA_RS04160enolase  [1] (data from MRSA252)
    SA_RS04575NADH dehydrogenase  [1] (data from MRSA252)
    SA_RS04710hypothetical protein  [1] (data from MRSA252)
    SA_RS05295phosphocarrier protein HPr  [1] (data from MRSA252)
    SA_RS05350pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SA_RS05355pyruvate dehydrogenase E1 component subunit beta  [1] (data from MRSA252)
    SA_RS05360dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex  [1] (data from MRSA252)
    SA_RS05365dihydrolipoyl dehydrogenase  [1] (data from MRSA252)
    SA_RS05630excinuclease ABC subunit C  [1] (data from MRSA252)
    SA_RS0614050S ribosomal protein L19  [1] (data from MRSA252)
    SA_RS0622530S ribosomal protein S2  [1] (data from MRSA252)
    SA_RS06295translation initiation factor IF-2  [1] (data from MRSA252)
    SA_RS06490glutamine synthetase  [1] (data from MRSA252)
    SA_RS07060dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex  [1] (data from MRSA252)
    SA_RS070652-oxoglutarate dehydrogenase E1 component  [1] (data from MRSA252)
    SA_RS07385DNA-binding protein HU  [1] (data from MRSA252)
    SA_RS07820superoxide dismutase  [1] (data from MRSA252)
    SA_RS07955molecular chaperone DnaK  [1] (data from MRSA252)
    SA_RS08435trigger factor  [1] (data from MRSA252)
    SA_RS08505aldehyde dehydrogenase  [1] (data from MRSA252)
    SA_RS08545isocitrate dehydrogenase (NADP(+))  [1] (data from MRSA252)
    SA_RS08560pyruvate kinase  [1] (data from MRSA252)
    SA_RS08630acetate kinase  [1] (data from MRSA252)
    SA_RS08860D-alanine aminotransferase  [1] (data from MRSA252)
    SA_RS11070UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [1] (data from MRSA252)
    SA_RS11090DNA-directed RNA polymerase subunit delta  [1] (data from MRSA252)
    SA_RS11245glutamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    SA_RS11430Asp23/Gls24 family envelope stress response protein  [1] (data from MRSA252)
    SA_RS1160550S ribosomal protein L13  [1] (data from MRSA252)
    SA_RS11635DNA-directed RNA polymerase subunit alpha  [1] (data from MRSA252)
    SA_RS1164530S ribosomal protein S13  [1] (data from MRSA252)
    SA_RS1168030S ribosomal protein S5  [1] (data from MRSA252)
    SA_RS1169050S ribosomal protein L6  [1] (data from MRSA252)
    SA_RS1172030S ribosomal protein S17  [1] (data from MRSA252)
    SA_RS1174050S ribosomal protein L22  [1] (data from MRSA252)
    SA_RS1174530S ribosomal protein S19  [1] (data from MRSA252)
    SA_RS13920arginine deiminase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.108
    • Ymax_pos: 67
    • Cmax: 0.117
    • Cmax_pos: 58
    • Smax: 0.126
    • Smax_pos: 22
    • Smean: 0.085
    • D: 0.099
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446151386 NCBI
  • RefSeq: WP_000229241 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MVEHYPFKIHSDFEPQGDQPQAIKEIVDGIKAGKRHQTLLGATGTGKTFTMSNVIKEVGKPTLIIAHNKTLAGQLYSEFKEFFPENRVEYFVSYYDYYQPEAYVPSTDTFIEKDASINDEIDQLRHSATSALFERDDVIIIASVSCIYGLGNPEEYKDLVVSVRVGMEMDRSELLRKLVDVQYTRNDIDFQRGTFRVRGDVVEIFPASKEELCIRVEFFGDEIDRIREVNYLTGEVLKEREHFAIFPASHFVTREEKLKVAIERIEKELEERLKELRDENKLLEAQRLEQRTNYDLEMMREMGFCSGIENYSVHLTLRPLGSTPYTLLDYFGDDWLVMIDESHVTLPQVRGMYNGDRARKQVLVDHGFRLPSALDNRPLKFEEFEEKTKQLVYVSATPGPYEIEHTDKMVEQIIRPTGLLDPKIEVRPTENQIDDLLSEIQTRVERNERVLVTTLTKKMSEDLTTYMKEAGIKVNYLHSEIKTLERIEIIRDLRMGTYDVIVGINLLREGIDIPEVSLVVILDADKEGFLRSNRSLIQTIGRAARNDKGEVIMYADKMTDSMKYAIDETQRRREIQMKHNEKHGITPKTINKKIHDLISATVENDENNDKAQTVIPKKMTKKERQKTIDNIEKEMKQAAKDLDFEKATELRDMLFELKAEG

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA_RS04060 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 1.49 1.50 1.51 1.52 1.53 1.54 1.55 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]