From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0823 [new locus tag: SACOL_RS04230 ]
  • pan locus tag?: SAUPAN002672000
  • symbol: uvrB
  • pan gene symbol?: uvrB
  • synonym:
  • product: excinuclease ABC subunit B

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL0823 [new locus tag: SACOL_RS04230 ]
  • symbol: uvrB
  • product: excinuclease ABC subunit B
  • replicon: chromosome
  • strand: +
  • coordinates: 845540..847531
  • length: 1992
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    GTGACAATGGTTGAACATTATCCTTTTAAAATACATTCTGATTTTGAGCCTCAAGGTGAC
    CAACCGCAAGCAATTAAAGAAATCGTGGAAGGTATTAAAGCGGGGAAAAGACATCAAACT
    TTATTAGGTGCTACTGGCACAGGGAAAACATTTACGATGAGTAATGTTATTAAAGAAGTT
    GGGAAACCAACGTTAATTATCGCGCATAACAAAACATTAGCAGGACAATTATATAGTGAG
    TTTAAAGAATTTTTTCCTGAAAACAGGGTGGAATACTTTGTAAGTTACTATGATTATTAT
    CAACCAGAGGCATACGTACCGTCTACTGACACTTTTATTGAAAAAGATGCCTCAATCAAT
    GATGAAATTGATCAACTACGACATTCTGCTACAAGTGCATTATTTGAACGCGATGATGTA
    ATTATTATTGCTAGTGTAAGTTGTATATATGGTTTAGGTAATCCTGAAGAATATAAAGAT
    TTAGTAGTAAGTGTTCGAGTTGGTATGGAAATGGATAGAAGTGAATTACTTAGAAAACTT
    GTAGATGTGCAATATACACGAAATGACATCGATTTCCAACGAGGAACGTTTCGAGTGCGT
    GGTGATGTAGTGGAAATATTCCCAGCCTCTAAAGAAGAACTTTGTATAAGGGTTGAGTTT
    TTCGGCGATGAGATTGACCGTATCCGAGAAGTTAACTACCTAACAGGTGAAGTGTTGAAA
    GAAAGAGAACATTTTGCGATATTCCCAGCTTCTCACTTCGTAACACGTGAAGAAAAGTTG
    AAAGTTGCGATTGAACGTATTGAAAAAGAATTGGAAGAACGATTGAAAGAATTACGAGAT
    GAGAATAAATTACTAGAAGCGCAAAGGTTAGAACAGCGTACCAACTATGATTTAGAAATG
    ATGCGAGAGATGGGATTCTGTTCAGGAATTGAAAACTATTCCGTACATTTAACTTTGCGA
    CCACTGGGTTCGACACCATATACTTTATTGGATTACTTTGGCGATGATTGGTTAGTAATG
    ATTGATGAATCACATGTGACATTACCGCAAGTTCGAGGCATGTATAACGGAGACAGAGCG
    CGTAAACAAGTTTTGGTGGATCATGGGTTTAGATTACCGAGTGCATTAGATAACCGTCCA
    CTTAAATTTGAAGAATTTGAAGAAAAGACAAAACAACTTGTGTATGTATCTGCAACGCCT
    GGACCATACGAAATTGAACATACGGATAAGATGGTTGAACAAATTATTCGTCCTACTGGT
    TTACTGGATCCTAAGATTGAGGTTAGACCTACTGAAAATCAAATTGACGATTTATTAAGT
    GAAATTCAAACAAGAGTTGAGCGTAATGAACGCGTACTTGTTACAACGCTCACTAAAAAG
    ATGAGTGAAGATTTAACCACATACATGAAAGAAGCGGGTATTAAAGTTAATTATCTGCAT
    TCAGAAATCAAGACATTAGAACGAATTGAAATAATTAGAGACTTACGAATGGGTACATAT
    GATGTTATCGTAGGTATTAATTTATTAAGAGAGGGTATTGATATACCAGAAGTTTCTCTA
    GTTGTCATATTAGATGCAGATAAAGAAGGGTTTTTACGTTCTAACCGCTCATTAATTCAA
    ACAATAGGTAGAGCTGCGCGTAACGATAAAGGTGAAGTCATTATGTATGCCGATAAAATG
    ACTGATTCGATGAAGTATGCAATTGATGAGACACAACGTCGTCGAGAAATACAGATGAAA
    CATAATGAAAAACATGGTATTACACCTAAAACAATTAATAAAAAAATACATGATTTAATT
    AGTGCTACTGTTGAAAATGACGAAAATAATGACAAAGCACAAACTGTGATACCTAAGAAG
    ATGACGAAAAAAGAACGTCAAAAGACAATCGACAATATAGAAAAAGAAATGAAACAAGCA
    GCGAAAGATTTAGATTTCGAGAAAGCTACAGAATTAAGAGATATGTTATTTGAATTAAAA
    GCAGAAGGGTGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    1992

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL0823 [new locus tag: SACOL_RS04230 ]
  • symbol: UvrB
  • description: excinuclease ABC subunit B
  • length: 663
  • theoretical pI: 5.05392
  • theoretical MW: 76880.1
  • GRAVY: -0.551131

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingDNA metabolismDNA replication, recombination, and repairexcinuclease ABC subunit B (TIGR00631; EC 3.1.25.-; HMM-score: 1110)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairtranscription-repair coupling factor (TIGR00580; EC 3.6.1.-; HMM-score: 65.4)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairATP-dependent DNA helicase RecG (TIGR00643; EC 3.6.4.12; HMM-score: 47.9)
    DNA phosphorothioation system restriction enzyme (TIGR04095; HMM-score: 40)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairprimosomal protein N' (TIGR00595; EC 3.6.1.-; HMM-score: 32.1)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairATP-dependent DNA helicase, RecQ family (TIGR00614; EC 3.6.4.12; HMM-score: 27.9)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairATP-dependent DNA helicase RecQ (TIGR01389; EC 3.6.4.12; HMM-score: 27.6)
    DEXH box helicase, DNA ligase-associated (TIGR04121; EC 3.6.4.-; HMM-score: 18.1)
    helicase/secretion neighborhood putative DEAH-box helicase (TIGR03817; HMM-score: 13.6)
  • TheSEED:  
    DNA MetabolismDNA repairDNA repair, UvrABC system Excinuclease ABC subunit B 
  • PFAM:
    P-loop_NTPase (CL0023) UvrB; Ultra-violet resistance protein B (PF12344; HMM-score: 84.2)
    Helicase_C; Helicase conserved C-terminal domain (PF00271; HMM-score: 73.4)
    ResIII; Type III restriction enzyme, res subunit (PF04851; HMM-score: 47.1)
    no clan definedUVR; UvrB/uvrC motif (PF02151; HMM-score: 35.4)
    P-loop_NTPase (CL0023) DEAD; DEAD/DEAH box helicase (PF00270; HMM-score: 23.8)
    AAA_30; AAA domain (PF13604; HMM-score: 21.5)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 16)
    Kinesin; Kinesin motor domain (PF00225; HMM-score: 13.6)
    MEDS; MEDS: MEthanogen/methylotroph, DcmR Sensory domain (PF14417; HMM-score: 12.8)
    AAA_19; AAA domain (PF13245; HMM-score: 12.7)
    DUF853; Bacterial protein of unknown function (DUF853) (PF05872; HMM-score: 12.4)
    TrwB_AAD_bind; Type IV secretion-system coupling protein DNA-binding domain (PF10412; HMM-score: 12.4)
    AAA_25; AAA domain (PF13481; HMM-score: 11.2)
    PDDEXK (CL0236) Sen15; Sen15 protein (PF09631; HMM-score: 10.7)
    Oxa1 (CL0376) DUF106; Integral membrane protein DUF106 (PF01956; HMM-score: 9.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SACOL1760(ackA)acetate kinase  [1] (data from MRSA252)
    SACOL0452(ahpC)alkyl hydroperoxide reductase subunit C  [1] (data from MRSA252)
    SACOL2657(arcA)arginine deiminase  [1] (data from MRSA252)
    SACOL0557(cysK)cysteine synthase  [1] (data from MRSA252)
    SACOL1800(dat)D-alanine aminotransferase  [1] (data from MRSA252)
    SACOL1637(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    SACOL0842(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    SACOL0634(eutD)phosphotransacetylase  [1] (data from MRSA252)
    SACOL1329(femC)glutamine synthetase  [1] (data from MRSA252)
    SACOL0593(fusA)elongation factor G  [1] (data from MRSA252)
    SACOL0838(gapA1)glyceraldehyde 3-phosphate dehydrogenase  [1] (data from MRSA252)
    SACOL1734(gapA2)glyceraldehyde 3-phosphate dehydrogenase 2  [1] (data from MRSA252)
    SACOL2145(glmS)glucosamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    SACOL0460(guaB)inosine-5'-monophosphate dehydrogenase  [1] (data from MRSA252)
    SACOL1513(hup)DNA-binding protein HU  [1] (data from MRSA252)
    SACOL1741(icd)isocitrate dehydrogenase  [1] (data from MRSA252)
    SACOL1288(infB)translation initiation factor IF-2  [1] (data from MRSA252)
    SACOL0222(ldh1)L-lactate dehydrogenase  [1] (data from MRSA252)
    SACOL2116(murAB)UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [1] (data from MRSA252)
    SACOL1102(pdhA)pyruvate dehydrogenase complex E1 component subunit alpha  [1] (data from MRSA252)
    SACOL1103(pdhB)pyruvate dehydrogenase complex E1 component subunit beta  [1] (data from MRSA252)
    SACOL1104(pdhC)branched-chain alpha-keto acid dehydrogenase E2  [1] (data from MRSA252)
    SACOL1105(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    SACOL0204(pflB)formate acetyltransferase  [1] (data from MRSA252)
    SACOL0841(pgm)phosphoglyceromutase  [1] (data from MRSA252)
    SACOL1091(ptsH)phosphocarrier protein HPr  [1] (data from MRSA252)
    SACOL1745(pyk)pyruvate kinase  [1] (data from MRSA252)
    SACOL2224(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    SACOL0585(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    SACOL0586(rplL)50S ribosomal protein L7/L12  [1] (data from MRSA252)
    SACOL2207(rplM)50S ribosomal protein L13  [1] (data from MRSA252)
    SACOL1257(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    SACOL2234(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    SACOL2213(rpoA)DNA-directed RNA polymerase subunit alpha  [1] (data from MRSA252)
    SACOL0589(rpoC)DNA-directed RNA polymerase subunit beta'  [1] (data from MRSA252)
    SACOL2120(rpoE)DNA-directed RNA polymerase subunit delta  [1] (data from MRSA252)
    SACOL1274(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    SACOL2222(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SACOL0592(rpsG)30S ribosomal protein S7  [1] (data from MRSA252)
    SACOL2215(rpsM)30S ribosomal protein S13  [1] (data from MRSA252)
    SACOL2230(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    SACOL0439(rpsR)30S ribosomal protein S18  [1] (data from MRSA252)
    SACOL2235(rpsS)30S ribosomal protein S19  [1] (data from MRSA252)
    SACOL1610(sodA2)superoxide dismutase  [1] (data from MRSA252)
    SACOL0095(spa)immunoglobulin G binding protein A precursor  [1] (data from MRSA252)
    SACOL1449(sucA)2-oxoglutarate dehydrogenase E1 component  [1] (data from MRSA252)
    SACOL1448(sucB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    SACOL1722(tig)trigger factor  [1] (data from MRSA252)
    SACOL0840(tpiA)triosephosphate isomerase  [1] (data from MRSA252)
    SACOL0594(tuf)elongation factor Tu  [1] (data from MRSA252)
    SACOL0824(uvrA)excinuclease ABC subunit A  [1] (data from MRSA252)
    SACOL1157(uvrC)excinuclease ABC subunit C  [1] (data from MRSA252)
    SACOL0521hypothetical protein  [1] (data from MRSA252)
    SACOL0731LysR family transcriptional regulator  [1] (data from MRSA252)
    SACOL0944NADH dehydrogenase  [1] (data from MRSA252)
    SACOL0973fumarylacetoacetate hydrolase  [1] (data from MRSA252)
    SACOL2173alkaline shock protein 23  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.106
    • Ymax_pos: 69
    • Cmax: 0.116
    • Cmax_pos: 60
    • Smax: 0.122
    • Smax_pos: 24
    • Smean: 0.088
    • D: 0.099
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MTMVEHYPFKIHSDFEPQGDQPQAIKEIVEGIKAGKRHQTLLGATGTGKTFTMSNVIKEVGKPTLIIAHNKTLAGQLYSEFKEFFPENRVEYFVSYYDYYQPEAYVPSTDTFIEKDASINDEIDQLRHSATSALFERDDVIIIASVSCIYGLGNPEEYKDLVVSVRVGMEMDRSELLRKLVDVQYTRNDIDFQRGTFRVRGDVVEIFPASKEELCIRVEFFGDEIDRIREVNYLTGEVLKEREHFAIFPASHFVTREEKLKVAIERIEKELEERLKELRDENKLLEAQRLEQRTNYDLEMMREMGFCSGIENYSVHLTLRPLGSTPYTLLDYFGDDWLVMIDESHVTLPQVRGMYNGDRARKQVLVDHGFRLPSALDNRPLKFEEFEEKTKQLVYVSATPGPYEIEHTDKMVEQIIRPTGLLDPKIEVRPTENQIDDLLSEIQTRVERNERVLVTTLTKKMSEDLTTYMKEAGIKVNYLHSEIKTLERIEIIRDLRMGTYDVIVGINLLREGIDIPEVSLVVILDADKEGFLRSNRSLIQTIGRAARNDKGEVIMYADKMTDSMKYAIDETQRRREIQMKHNEKHGITPKTINKKIHDLISATVENDENNDKAQTVIPKKMTKKERQKTIDNIEKEMKQAAKDLDFEKATELRDMLFELKAEG

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [2] [3] [4]
    quantitative data / protein copy number per cell: 28 [5]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: LexA
    LexA (TF) important in SOS responseRegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 1.49 1.50 1.51 1.52 1.53 1.54 1.55 1.56 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  2. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  3. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J. Proteome Res.: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  4. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  5. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]