From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS04230 [old locus tag: SACOL0823 ]
  • pan locus tag?: SAUPAN002672000
  • symbol: SACOL_RS04230
  • pan gene symbol?: uvrB
  • synonym:
  • product: excinuclease ABC subunit B

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS04230 [old locus tag: SACOL0823 ]
  • symbol: SACOL_RS04230
  • product: excinuclease ABC subunit B
  • replicon: chromosome
  • strand: +
  • coordinates: 845546..847531
  • length: 1986
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (845546..847531) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    ATGGTTGAACATTATCCTTTTAAAATACATTCTGATTTTGAGCCTCAAGGTGACCAACCG
    CAAGCAATTAAAGAAATCGTGGAAGGTATTAAAGCGGGGAAAAGACATCAAACTTTATTA
    GGTGCTACTGGCACAGGGAAAACATTTACGATGAGTAATGTTATTAAAGAAGTTGGGAAA
    CCAACGTTAATTATCGCGCATAACAAAACATTAGCAGGACAATTATATAGTGAGTTTAAA
    GAATTTTTTCCTGAAAACAGGGTGGAATACTTTGTAAGTTACTATGATTATTATCAACCA
    GAGGCATACGTACCGTCTACTGACACTTTTATTGAAAAAGATGCCTCAATCAATGATGAA
    ATTGATCAACTACGACATTCTGCTACAAGTGCATTATTTGAACGCGATGATGTAATTATT
    ATTGCTAGTGTAAGTTGTATATATGGTTTAGGTAATCCTGAAGAATATAAAGATTTAGTA
    GTAAGTGTTCGAGTTGGTATGGAAATGGATAGAAGTGAATTACTTAGAAAACTTGTAGAT
    GTGCAATATACACGAAATGACATCGATTTCCAACGAGGAACGTTTCGAGTGCGTGGTGAT
    GTAGTGGAAATATTCCCAGCCTCTAAAGAAGAACTTTGTATAAGGGTTGAGTTTTTCGGC
    GATGAGATTGACCGTATCCGAGAAGTTAACTACCTAACAGGTGAAGTGTTGAAAGAAAGA
    GAACATTTTGCGATATTCCCAGCTTCTCACTTCGTAACACGTGAAGAAAAGTTGAAAGTT
    GCGATTGAACGTATTGAAAAAGAATTGGAAGAACGATTGAAAGAATTACGAGATGAGAAT
    AAATTACTAGAAGCGCAAAGGTTAGAACAGCGTACCAACTATGATTTAGAAATGATGCGA
    GAGATGGGATTCTGTTCAGGAATTGAAAACTATTCCGTACATTTAACTTTGCGACCACTG
    GGTTCGACACCATATACTTTATTGGATTACTTTGGCGATGATTGGTTAGTAATGATTGAT
    GAATCACATGTGACATTACCGCAAGTTCGAGGCATGTATAACGGAGACAGAGCGCGTAAA
    CAAGTTTTGGTGGATCATGGGTTTAGATTACCGAGTGCATTAGATAACCGTCCACTTAAA
    TTTGAAGAATTTGAAGAAAAGACAAAACAACTTGTGTATGTATCTGCAACGCCTGGACCA
    TACGAAATTGAACATACGGATAAGATGGTTGAACAAATTATTCGTCCTACTGGTTTACTG
    GATCCTAAGATTGAGGTTAGACCTACTGAAAATCAAATTGACGATTTATTAAGTGAAATT
    CAAACAAGAGTTGAGCGTAATGAACGCGTACTTGTTACAACGCTCACTAAAAAGATGAGT
    GAAGATTTAACCACATACATGAAAGAAGCGGGTATTAAAGTTAATTATCTGCATTCAGAA
    ATCAAGACATTAGAACGAATTGAAATAATTAGAGACTTACGAATGGGTACATATGATGTT
    ATCGTAGGTATTAATTTATTAAGAGAGGGTATTGATATACCAGAAGTTTCTCTAGTTGTC
    ATATTAGATGCAGATAAAGAAGGGTTTTTACGTTCTAACCGCTCATTAATTCAAACAATA
    GGTAGAGCTGCGCGTAACGATAAAGGTGAAGTCATTATGTATGCCGATAAAATGACTGAT
    TCGATGAAGTATGCAATTGATGAGACACAACGTCGTCGAGAAATACAGATGAAACATAAT
    GAAAAACATGGTATTACACCTAAAACAATTAATAAAAAAATACATGATTTAATTAGTGCT
    ACTGTTGAAAATGACGAAAATAATGACAAAGCACAAACTGTGATACCTAAGAAGATGACG
    AAAAAAGAACGTCAAAAGACAATCGACAATATAGAAAAAGAAATGAAACAAGCAGCGAAA
    GATTTAGATTTCGAGAAAGCTACAGAATTAAGAGATATGTTATTTGAATTAAAAGCAGAA
    GGGTGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    1986

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS04230 [old locus tag: SACOL0823 ]
  • symbol: SACOL_RS04230
  • description: excinuclease ABC subunit B
  • length: 661
  • theoretical pI: 5.05392
  • theoretical MW: 76647.8
  • GRAVY: -0.554614

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingDNA metabolismDNA replication, recombination, and repairexcinuclease ABC subunit B (TIGR00631; EC 3.1.25.-; HMM-score: 1110)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairtranscription-repair coupling factor (TIGR00580; EC 3.6.1.-; HMM-score: 65.7)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairATP-dependent DNA helicase RecG (TIGR00643; EC 3.6.4.12; HMM-score: 47.4)
    DNA phosphorothioation system restriction enzyme (TIGR04095; HMM-score: 40)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairprimosomal protein N' (TIGR00595; EC 3.6.1.-; HMM-score: 32.2)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairATP-dependent DNA helicase, RecQ family (TIGR00614; EC 3.6.4.12; HMM-score: 27.9)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairATP-dependent DNA helicase RecQ (TIGR01389; EC 3.6.4.12; HMM-score: 27.6)
    DEXH box helicase, DNA ligase-associated (TIGR04121; EC 3.6.4.-; HMM-score: 18.1)
    helicase/secretion neighborhood putative DEAH-box helicase (TIGR03817; HMM-score: 13.6)
  • TheSEED:
  • PFAM:
    P-loop_NTPase (CL0023) UvrB; Ultra-violet resistance protein B (PF12344; HMM-score: 84.2)
    Helicase_C; Helicase conserved C-terminal domain (PF00271; HMM-score: 73.4)
    ResIII; Type III restriction enzyme, res subunit (PF04851; HMM-score: 47.1)
    no clan definedUVR; UvrB/uvrC motif (PF02151; HMM-score: 35.4)
    P-loop_NTPase (CL0023) DEAD; DEAD/DEAH box helicase (PF00270; HMM-score: 23.9)
    AAA_30; AAA domain (PF13604; HMM-score: 21.5)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 16)
    Kinesin; Kinesin motor domain (PF00225; HMM-score: 13.5)
    MEDS; MEDS: MEthanogen/methylotroph, DcmR Sensory domain (PF14417; HMM-score: 12.8)
    AAA_19; AAA domain (PF13245; HMM-score: 12.7)
    DUF853; Bacterial protein of unknown function (DUF853) (PF05872; HMM-score: 12.4)
    TrwB_AAD_bind; Type IV secretion-system coupling protein DNA-binding domain (PF10412; HMM-score: 12.4)
    AAA_25; AAA domain (PF13481; HMM-score: 11.3)
    PDDEXK (CL0236) Sen15; Sen15 protein (PF09631; HMM-score: 10.7)
    Oxa1 (CL0376) DUF106; Integral membrane protein DUF106 (PF01956; HMM-score: 9.9)

Structure, modifications & interactions[edit source | edit]

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.108
    • Ymax_pos: 67
    • Cmax: 0.117
    • Cmax_pos: 58
    • Smax: 0.126
    • Smax_pos: 22
    • Smean: 0.086
    • D: 0.099
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446151398 NCBI
  • RefSeq: WP_000229253 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MVEHYPFKIHSDFEPQGDQPQAIKEIVEGIKAGKRHQTLLGATGTGKTFTMSNVIKEVGKPTLIIAHNKTLAGQLYSEFKEFFPENRVEYFVSYYDYYQPEAYVPSTDTFIEKDASINDEIDQLRHSATSALFERDDVIIIASVSCIYGLGNPEEYKDLVVSVRVGMEMDRSELLRKLVDVQYTRNDIDFQRGTFRVRGDVVEIFPASKEELCIRVEFFGDEIDRIREVNYLTGEVLKEREHFAIFPASHFVTREEKLKVAIERIEKELEERLKELRDENKLLEAQRLEQRTNYDLEMMREMGFCSGIENYSVHLTLRPLGSTPYTLLDYFGDDWLVMIDESHVTLPQVRGMYNGDRARKQVLVDHGFRLPSALDNRPLKFEEFEEKTKQLVYVSATPGPYEIEHTDKMVEQIIRPTGLLDPKIEVRPTENQIDDLLSEIQTRVERNERVLVTTLTKKMSEDLTTYMKEAGIKVNYLHSEIKTLERIEIIRDLRMGTYDVIVGINLLREGIDIPEVSLVVILDADKEGFLRSNRSLIQTIGRAARNDKGEVIMYADKMTDSMKYAIDETQRRREIQMKHNEKHGITPKTINKKIHDLISATVENDENNDKAQTVIPKKMTKKERQKTIDNIEKEMKQAAKDLDFEKATELRDMLFELKAEG

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS04230 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 1.49 1.50 1.51 1.52 1.53 1.54 1.55 1.56 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]