From AureoWiki
Jump to: navigation, search

NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS11975 [old locus tag: SA2084 ]
  • pan locus tag?: SAUPAN005755000
  • symbol: SA_RS11975
  • pan gene symbol?: ureC
  • synonym:
  • product: urease subunit alpha

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA_RS11975 [old locus tag: SA2084 ]
  • symbol: SA_RS11975
  • product: urease subunit alpha
  • replicon: chromosome
  • strand: +
  • coordinates: 2343583..2345298
  • length: 1716
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002745 (2343583..2345298) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    ATGAGCTTTAAAATGACGCAAAATCAATATACGAGCTTATACGGTCCAACTGTTGGAGAT
    TCTATTCGTTTAGGTGATACGAATCTATTTGCTCAAATAGAAAAAGACTATGCGGTTTAT
    GGTGAAGAAGCTACTTTTGGTGGTGGTAAATCTATTAGAGACGGTATGGCGCAAAATCCT
    CGTGTAACACGTGATGACGTGAACGTTGCAGACCTTGTCATTTCTAATGCCGTTATTATC
    GATTACGATAAAGTGGTTAAAGCTGATATAGGCATTAAAAATGGTTATATTTTCGCCATA
    GGTAATGCCGGCAACCCAGATATAATGGATAATGTCGACATTATTATAGGTTCAACAACA
    GATATCATTGCCGCTGAAGGTAAAATCGTCACTGCTGGTGGTATTGATACTCATGTTCAT
    TTTATTAATCCTGAACAAGCAGAGGTCGCATTAGAAAGTGGTATTACGACTCATATTGGT
    GGTGGTACTGGTGCTTCAGAAGGTTCTAAAGCAACAACTGTAACTCCAGGTCCATGGCAT
    ATTCATAGAATGTTAGAAGCTGCCGAAGGTTTACCGATTAATGTCGGTTTTACAGGTAAA
    GGACAAGCAACAAATCCAACTGCACTCATTGAACAAATCAATGCCGGAGCAATTGGATTA
    AAAGTACATGAAGACTGGGGTGCAACACCATCTGCTTTGAGTCATGCATTAGATGTTGCT
    GATGAATTTGATGTTCAAATTGCATTACATGCAGATACTTTAAATGAAGCAGGATTTATG
    GAAGACACAATGGCTGCTGTTAAAGACCGTGTACTTCATATGTACCATACTGAAGGTGCT
    GGTGGCGGTCATGCGCCTGATTTAATTAAATCCGCTGCATTTTCAAATATTTTACCTTCA
    TCTACAAATCCAACTTTGCCTTATACACATAATACTGTAGATGAACATTTAGATATGGTA
    ATGATTACTCACCATTTAAATGCGGCTATTCCTGAAGATATCGCATTCGCAGATTCACGT
    ATTCGTAAAGAAACGATTGCAGCAGAAGATGTTCTGCAAGATATGGGTGTATTCAGTATG
    ATTAGTTCCGATTCACAAGCAATGGGCCGTGTAGGTGAAGTAATTACACGAACATGGCAA
    GTAGCACATCGCATGAAAGAACAACGTGGTCCTTTAGATGGTGATTTTGAACATAATGAT
    AATAATCGCATCAAACGTTATATCGCTAAATATACAATTAACCCAGCAATTACACATGGT
    ATTTCTGAATATGTAGGATCTATCGAGCCGGGCAAACTAGCTGACATTGTCTTATGGGAC
    CCAATTTTCTTTGGGGTTAAACCTGAATTAGTTGTAAAGGGCGGATTAATTAACTCTGCC
    GTAAATGGCGATGCAAATGGTTCTATACCTACATCTGAACCGATGAAGTACCGTAAAATG
    TATGGTCAATACGGCGGAAACCTTACAAGTACGTCAATGACATTCGTGTCTAAAACTGCT
    TATGAAAATGGTATCAATCGTGCATTAAATTTAAAACGCATGGTGCGTCCAGTTAAAAAT
    ATTAGACAATTATCTAAAGCAGATATGAAAAATAACAGTGCAACACCTAAATTAGACGTT
    GATCCACAAACATATGAAGTATATGTAGATGGAGAAAAAATTACAAGTAATGCAGCAACT
    GAGTTACCATTAACTCAAAGATACTTCTTATTCTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1716

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA_RS11975 [old locus tag: SA2084 ]
  • symbol: SA_RS11975
  • description: urease subunit alpha
  • length: 571
  • theoretical pI: 5.06399
  • theoretical MW: 61779.2
  • GRAVY: -0.226445

Function[edit source | edit]

  • reaction:
    EC 3.5.1.5?  ExPASy
    UreaseUrea + H2O = CO2 + 2 NH3
  • TIGRFAM:
    MetabolismCentral intermediary metabolismNitrogen metabolismurease, alpha subunit (TIGR01792; EC 3.5.1.5; HMM-score: 1027.6)
    and 8 more
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesSalvage of nucleosides and nucleotidesadenine deaminase (TIGR01178; EC 3.5.4.2; HMM-score: 28)
    allantoinase (TIGR03178; EC 3.5.2.5; HMM-score: 27.9)
    dihydropyrimidinase (TIGR02033; EC 3.5.2.2; HMM-score: 25.4)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesPyrimidine ribonucleotide biosynthesisdihydroorotase, multifunctional complex type (TIGR00857; EC 3.5.2.3; HMM-score: 24.3)
    MetabolismEnergy metabolismAmino acids and aminesimidazolonepropionase (TIGR01224; EC 3.5.2.7; HMM-score: 22.9)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesOtherguanine deaminase (TIGR02967; EC 3.5.4.3; HMM-score: 18)
    MetabolismEnergy metabolismOtherphosphonate metabolism protein PhnM (TIGR02318; HMM-score: 16.3)
    formylmethanofuran dehydrogenase subunit A (TIGR03121; EC 1.2.99.5; HMM-score: 13)
  • TheSEED:
  • PFAM:
    Amidohydrolase (CL0034) Amidohydro_1; Amidohydrolase family (PF01979; HMM-score: 258.7)
    and 2 more
    Urease_alpha; Urease alpha-subunit, N-terminal domain (PF00449; HMM-score: 168.9)
    Amidohydro_3; Amidohydrolase family (PF07969; HMM-score: 44.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: Ni cation
  • effectors:
  • protein partners:
    SA_RS11130(deoA)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    SA_RS09855(gatA)glutamyl-tRNA(Gln) amidotransferase subunit A  [1] (data from MRSA252)
    SA_RS00150DNA polymerase III subunit beta  [1] (data from MRSA252)
    SA_RS00310aminoglycoside O-nucleotidyltransferase ANT(4')-Ia  [1] (data from MRSA252)
    SA_RS01275formate acetyltransferase  [1] (data from MRSA252)
    SA_RS01365L-lactate dehydrogenase  [1] (data from MRSA252)
    SA_RS02005GTP-binding protein YchF  [1] (data from MRSA252)
    SA_RS02735lysine--tRNA ligase  [1] (data from MRSA252)
    SA_RS02810pyridoxal 5'-phosphate synthase lyase subunit PdxS  [1] (data from MRSA252)
    SA_RS0290550S ribosomal protein L11  [1] (data from MRSA252)
    SA_RS0291050S ribosomal protein L1  [1] (data from MRSA252)
    SA_RS0291550S ribosomal protein L10  [1] (data from MRSA252)
    SA_RS0292050S ribosomal protein L7/L12  [1] (data from MRSA252)
    SA_RS0295030S ribosomal protein S7  [1] (data from MRSA252)
    SA_RS02955elongation factor G  [1] (data from MRSA252)
    SA_RS02960elongation factor Tu  [1] (data from MRSA252)
    SA_RS03910ribonucleotide-diphosphate reductase subunit alpha  [1] (data from MRSA252)
    SA_RS03915ribonucleotide-diphosphate reductase subunit beta  [1] (data from MRSA252)
    SA_RS04160enolase  [1] (data from MRSA252)
    SA_RS04420ABC transporter ATP-binding protein  [1] (data from MRSA252)
    SA_RS04575NADH dehydrogenase  [1] (data from MRSA252)
    SA_RS04710hypothetical protein  [1] (data from MRSA252)
    SA_RS04915enoyl-ACP reductase  [1] (data from MRSA252)
    SA_RS05190bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase  [1] (data from MRSA252)
    SA_RS05350pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SA_RS05355pyruvate dehydrogenase E1 component subunit beta  [1] (data from MRSA252)
    SA_RS05360dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex  [1] (data from MRSA252)
    SA_RS05365dihydrolipoyl dehydrogenase  [1] (data from MRSA252)
    SA_RS05860cell division protein FtsZ  [1] (data from MRSA252)
    SA_RS05945carbamoyl-phosphate synthase large chain  [1] (data from MRSA252)
    SA_RS0614050S ribosomal protein L19  [1] (data from MRSA252)
    SA_RS0622530S ribosomal protein S2  [1] (data from MRSA252)
    SA_RS06240UMP kinase  [1] (data from MRSA252)
    SA_RS06265proline--tRNA ligase  [1] (data from MRSA252)
    SA_RS06295translation initiation factor IF-2  [1] (data from MRSA252)
    SA_RS06445glycerol kinase  [1] (data from MRSA252)
    SA_RS07060dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex  [1] (data from MRSA252)
    SA_RS07205serine/threonine dehydratase  [1] (data from MRSA252)
    SA_RS07685acetyl-CoA carboxylase biotin carboxylase subunit  [1] (data from MRSA252)
    SA_RS07730glycine dehydrogenase  [1] (data from MRSA252)
    SA_RS07955molecular chaperone DnaK  [1] (data from MRSA252)
    SA_RS0829550S ribosomal protein L21  [1] (data from MRSA252)
    SA_RS08430ATP-dependent Clp protease ATP-binding subunit ClpX  [1] (data from MRSA252)
    SA_RS08470translation initiation factor IF-3  [1] (data from MRSA252)
    SA_RS08505aldehyde dehydrogenase  [1] (data from MRSA252)
    SA_RS08545isocitrate dehydrogenase (NADP(+))  [1] (data from MRSA252)
    SA_RS08560pyruvate kinase  [1] (data from MRSA252)
    SA_RS08625universal stress protein UspA  [1] (data from MRSA252)
    SA_RS08630acetate kinase  [1] (data from MRSA252)
    SA_RS0867530S ribosomal protein S4  [1] (data from MRSA252)
    SA_RS09055S-adenosylmethionine synthase  [1] (data from MRSA252)
    SA_RS09850aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B  [1] (data from MRSA252)
    SA_RS10855D-alanine--D-alanine ligase  [1] (data from MRSA252)
    SA_RS10945UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [1] (data from MRSA252)
    SA_RS11010uracil phosphoribosyltransferase  [1] (data from MRSA252)
    SA_RS11060aldehyde dehydrogenase family protein  [1] (data from MRSA252)
    SA_RS11070UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [1] (data from MRSA252)
    SA_RS11245glutamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    SA_RS11430Asp23/Gls24 family envelope stress response protein  [1] (data from MRSA252)
    SA_RS1160030S ribosomal protein S9  [1] (data from MRSA252)
    SA_RS1160550S ribosomal protein L13  [1] (data from MRSA252)
    SA_RS1167050S ribosomal protein L15  [1] (data from MRSA252)
    SA_RS1168030S ribosomal protein S5  [1] (data from MRSA252)
    SA_RS1169050S ribosomal protein L6  [1] (data from MRSA252)
    SA_RS1170550S ribosomal protein L5  [1] (data from MRSA252)
    SA_RS1173530S ribosomal protein S3  [1] (data from MRSA252)
    SA_RS1174050S ribosomal protein L22  [1] (data from MRSA252)
    SA_RS1175050S ribosomal protein L2  [1] (data from MRSA252)
    SA_RS1175550S ribosomal protein L23  [1] (data from MRSA252)
    SA_RS1176050S ribosomal protein L4  [1] (data from MRSA252)
    SA_RS1176550S ribosomal protein L3  [1] (data from MRSA252)
    SA_RS1177030S ribosomal protein S10  [1] (data from MRSA252)
    SA_RS12040octopine dehydrogenase  [1] (data from MRSA252)
    SA_RS13075phosphoglucomutase  [1] (data from MRSA252)
    SA_RS13340pyruvate oxidase  [1] (data from MRSA252)
    SA_RS13375hydroxymethylglutaryl-CoA synthase  [1] (data from MRSA252)
    SA_RS13735malate:quinone oxidoreductase  [1] (data from MRSA252)
    SA_RS13920arginine deiminase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.149
    • Ymax_pos: 32
    • Cmax: 0.181
    • Cmax_pos: 32
    • Smax: 0.229
    • Smax_pos: 8
    • Smean: 0.149
    • D: 0.149
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 445930818 NCBI
  • RefSeq: WP_000008673 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MSFKMTQNQYTSLYGPTVGDSIRLGDTNLFAQIEKDYAVYGEEATFGGGKSIRDGMAQNPRVTRDDVNVADLVISNAVIIDYDKVVKADIGIKNGYIFAIGNAGNPDIMDNVDIIIGSTTDIIAAEGKIVTAGGIDTHVHFINPEQAEVALESGITTHIGGGTGASEGSKATTVTPGPWHIHRMLEAAEGLPINVGFTGKGQATNPTALIEQINAGAIGLKVHEDWGATPSALSHALDVADEFDVQIALHADTLNEAGFMEDTMAAVKDRVLHMYHTEGAGGGHAPDLIKSAAFSNILPSSTNPTLPYTHNTVDEHLDMVMITHHLNAAIPEDIAFADSRIRKETIAAEDVLQDMGVFSMISSDSQAMGRVGEVITRTWQVAHRMKEQRGPLDGDFEHNDNNRIKRYIAKYTINPAITHGISEYVGSIEPGKLADIVLWDPIFFGVKPELVVKGGLINSAVNGDANGSIPTSEPMKYRKMYGQYGGNLTSTSMTFVSKTAYENGINRALNLKRMVRPVKNIRQLSKADMKNNSATPKLDVDPQTYEVYVDGEKITSNAATELPLTQRYFLF

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA_RS11975 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 1.49 1.50 1.51 1.52 1.53 1.54 1.55 1.56 1.57 1.58 1.59 1.60 1.61 1.62 1.63 1.64 1.65 1.66 1.67 1.68 1.69 1.70 1.71 1.72 1.73 1.74 1.75 1.76 1.77 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]