From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS02485 [old locus tag: SA0436 ]
  • pan locus tag?: SAUPAN002198000
  • symbol: SA_RS02485
  • pan gene symbol?: dnaX
  • synonym:
  • product: DNA polymerase III subunit gamma/tau

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA_RS02485 [old locus tag: SA0436 ]
  • symbol: SA_RS02485
  • product: DNA polymerase III subunit gamma/tau
  • replicon: chromosome
  • strand: +
  • coordinates: 502594..504291
  • length: 1698
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002745 (502594..504291) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    TTGAATTATCAAGCCTTATATCGTATGTACAGACCCCAAAGTTTCGAGGATGTCGTCGGA
    CAAGAACATGTCACGAAGACATTGCGCAATGCGATTTCGAAAGAAAAACAGTCGCATGCT
    TATATTTTTAGTGGTCCGAGAGGTACGGGGAAAACGAGTATTGCCAAAGTGTTTGCTAAA
    GCAATCAACTGTCTAAATAGCACTGATGGAGAACCTTGTAATGAATGTCATATTTGTAAA
    GGCATTACGCAGGGGACTAATTCAGATGTGATAGAAATTGATGCTGCTAGTAATAATGGC
    GTTGATGAAATAAGAAATATTAGAGACAAAGTTAAATATGCACCAAGTGAATCGAAATAT
    AAAGTTTATATTATAGATGAGGTGCACATGCTAACAACAGGTGCTTTTAATGCCCTTTTA
    AAGACGTTAGAAGAACCTCCAGCACACGCTATTTTTATATTGGCAACGACAGAACCACAT
    AAAATCCCTCCAACAATCATTTCTAGGGCACAACGTTTTGATTTTAAAGCAATTAGCCTA
    GATCAAATTGTTGAACGTTTAAAATTTGTAGCAGATGCACAACAAATTGAATGTGAAGAT
    GAAGCCTTGGCATTTATCGCTAAAGCGTCTGAAGGGGGTATGCGTGATGCATTAAGTATT
    ATGGATCAGGCTATTGCATTTGGTGATGGTACGTTAACATTGCAAGATGCGTTGAATGTC
    ACAGGTAGCGTACATGATGAAGCGTTGGATCACTTGTTTGATGATATTGTACAAGGTGAC
    GTACAAGCATCTTTTAAAAAATACCATCAGTTTATAACAGAGGGTAAAGAAGTGAATCGC
    CTAATAAATGATATGATTTATTTTGTCAGAGATACGATTATGAATAAAACATCTGAGAAA
    GATACTGAGTATCGAGCACTGATGAACTTAGAATTAGATATGTTATATCAAATGATTGAT
    CTTATTAATGATACATTAGTGTCGATTCGTTTTAGTGTGAATCAAAACGTTCATTTTGAA
    GTGTTGTTAGTAAAATTAGCTGAGCAGATTAAGGGTCAACCACAAGTGATTGCGAATGTA
    GCTGAACCAGCACAAATTGCTTCATCGCCAAACACAGATGTATTGTTGCAACGTATGGAA
    CAGTTAGAGCAAGAATTAAAAACACTAAAAGCACAAGGAGTGAGTGTCGCTCCTGCTCAA
    AAATCTTCGAAAAAGCCTGCGAGAGGCATACAAAAATCTAAAAATGCATTTTCAATGCAA
    CAAATTGCAAAAGTGCTAGATAAAGCGAATAAGGCAGATATCAAATTGTTGAAAGATCAT
    TGGCAAGAAGTGATTGATCATGCCAAAAACAATGATAAAAAATCACTCGTTAGTTTATTG
    CAAAATTCGGAACCTGTGGCGGCAAGTGAAGATCACGTACTTGTGAAATTTGAGGAAGAG
    ATCCATTGTGAAATCGTCAATAAAGACGACGAGAAACGTAGTAGTATAGAAAGTGTTGTA
    TGTAATATCGTTAATAAAAACGTTAAAGTTGTTGGTGTACCATCAGATCAATGGCAAAGA
    GTTCGAACGGAGTATTTACAAAATCGTAAAAACGAAGGCGATGATATGCCAAAGCAACAA
    GCACAACAAACAGATATTGCTCAAAAAGCAAAAGATCTTTTCGGTGAAGAAACTGTACAT
    GTGATAGATGAAGAGTGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1698

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA_RS02485 [old locus tag: SA0436 ]
  • symbol: SA_RS02485
  • description: DNA polymerase III subunit gamma/tau
  • length: 565
  • theoretical pI: 5.32796
  • theoretical MW: 63470.6
  • GRAVY: -0.422478

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA polymerase III, subunit gamma and tau (TIGR02397; EC 2.7.7.7; HMM-score: 461.8)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA polymerase III, delta' subunit (TIGR00678; EC 2.7.7.7; HMM-score: 168.2)
    Cellular processesCellular processesSporulation and germinationATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 40.9)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 40.9)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairHolliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 35)
    Cellular processesCellular processesSporulation and germinationATP-dependent protease, Lon family (TIGR02903; EC 3.4.21.-; HMM-score: 32)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent protease, Lon family (TIGR02903; EC 3.4.21.-; HMM-score: 32)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA polymerase III, delta subunit (TIGR01128; EC 2.7.7.7; HMM-score: 24.9)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype VII secretion AAA-ATPase EccA (TIGR03922; HMM-score: 22)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairorc1/cdc6 family replication initiation protein (TIGR02928; HMM-score: 17.1)
    Cellular processesCellular processesSporulation and germinationstage V sporulation protein K (TIGR02881; HMM-score: 15.6)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesendopeptidase La (TIGR00763; EC 3.4.21.53; HMM-score: 15.3)
  • TheSEED:
  • PFAM:
    P-loop_NTPase (CL0023) DNA_pol3_delta2; DNA polymerase III, delta subunit (PF13177; HMM-score: 161.9)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 54.2)
    RuvB_N; Holliday junction DNA helicase ruvB N-terminus (PF05496; HMM-score: 33.5)
    TIP49; TIP49 C-terminus (PF06068; HMM-score: 28.6)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 24.4)
    post-AAA (CL0604) DNA_pol3_gamma3; DNA polymerase III subunits gamma and tau domain III (PF12169; HMM-score: 24)
    P-loop_NTPase (CL0023) AAA_30; AAA domain (PF13604; HMM-score: 22.9)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 22.5)
    AAA_19; AAA domain (PF13245; HMM-score: 21.1)
    PIF1; PIF1-like helicase (PF05970; HMM-score: 20.4)
    AAA_22; AAA domain (PF13401; HMM-score: 20.2)
    AAA_14; AAA domain (PF13173; HMM-score: 20)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 18.8)
    AAA_18; AAA domain (PF13238; HMM-score: 18.5)
    TniB; Bacterial TniB protein (PF05621; HMM-score: 17.7)
    no clan definedAAA_assoc_2; AAA C-terminal domain (PF16193; HMM-score: 17)
    P-loop_NTPase (CL0023) AAA_24; AAA domain (PF13479; HMM-score: 16.9)
    ResIII; Type III restriction enzyme, res subunit (PF04851; HMM-score: 16.9)
    T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 14.3)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 12.6)
    no clan definedCom_YlbF; Control of competence regulator ComK, YlbF/YmcA (PF06133; HMM-score: 7.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA_RS06280(nusA)transcription termination/antitermination protein NusA  [1] (data from MRSA252)
    SA_RS06270(polC)DNA polymerase III subunit alpha  [1] (data from MRSA252)
    SA_RS00150DNA polymerase III subunit beta  [1] (data from MRSA252)
    SA_RS00310aminoglycoside O-nucleotidyltransferase ANT(4')-Ia  [1] (data from MRSA252)
    SA_RS00335PBP2a family beta-lactam-resistant peptidoglycan transpeptidase MecA  [1] (data from MRSA252)
    SA_RS00690immunoglobulin G-binding protein A  [1] (data from MRSA252)
    SA_RS01275formate acetyltransferase  [1] (data from MRSA252)
    SA_RS01960acetyl-CoA acyltransferase  [1] (data from MRSA252)
    SA_RS02020single-stranded DNA-binding protein  [1] (data from MRSA252)
    SA_RS02095alkyl hydroperoxide reductase subunit C  [1] (data from MRSA252)
    SA_RS02120hypothetical protein  [1] (data from MRSA252)
    SA_RS02145IMP dehydrogenase  [1] (data from MRSA252)
    SA_RS02490YbaB/EbfC family nucleoid-associated protein  [1] (data from MRSA252)
    SA_RS02640ribose-phosphate pyrophosphokinase  [1] (data from MRSA252)
    SA_RS0265050S ribosomal protein L25/general stress protein Ctc  [1] (data from MRSA252)
    SA_RS02710cysteine synthase  [1] (data from MRSA252)
    SA_RS02810pyridoxal 5'-phosphate synthase lyase subunit PdxS  [1] (data from MRSA252)
    SA_RS02860glutamate--tRNA ligase  [1] (data from MRSA252)
    SA_RS02900transcription termination/antitermination protein NusG  [1] (data from MRSA252)
    SA_RS0291050S ribosomal protein L1  [1] (data from MRSA252)
    SA_RS0291550S ribosomal protein L10  [1] (data from MRSA252)
    SA_RS0292050S ribosomal protein L7/L12  [1] (data from MRSA252)
    SA_RS02930DNA-directed RNA polymerase subunit beta  [1] (data from MRSA252)
    SA_RS02935DNA-directed RNA polymerase subunit beta'  [1] (data from MRSA252)
    SA_RS0295030S ribosomal protein S7  [1] (data from MRSA252)
    SA_RS02955elongation factor G  [1] (data from MRSA252)
    SA_RS02960elongation factor Tu  [1] (data from MRSA252)
    SA_RS02990branched chain amino acid aminotransferase  [1] (data from MRSA252)
    SA_RS030703-hexulose-6-phosphate synthase  [1] (data from MRSA252)
    SA_RS03155phosphate acetyltransferase  [1] (data from MRSA252)
    SA_RS03545hypothetical protein  [1] (data from MRSA252)
    SA_RS03575transcriptional regulator  [1] (data from MRSA252)
    SA_RS03645hypothetical protein  [1] (data from MRSA252)
    SA_RS04020ribosomal subunit interface protein  [1] (data from MRSA252)
    SA_RS04090thioredoxin reductase  [1] (data from MRSA252)
    SA_RS04140aldehyde dehydrogenase  [1] (data from MRSA252)
    SA_RS04145phosphoglycerate kinase  [1] (data from MRSA252)
    SA_RS04150triose-phosphate isomerase  [1] (data from MRSA252)
    SA_RS041552,3-bisphosphoglycerate-independent phosphoglycerate mutase  [1] (data from MRSA252)
    SA_RS04160enolase  [1] (data from MRSA252)
    SA_RS04330glycine cleavage system protein H  [1] (data from MRSA252)
    SA_RS04540D-alanine--poly(phosphoribitol) ligase subunit 2  [1] (data from MRSA252)
    SA_RS04575NADH dehydrogenase  [1] (data from MRSA252)
    SA_RS04680glucose-6-phosphate isomerase  [1] (data from MRSA252)
    SA_RS04785beta-ketoacyl-[acyl-carrier-protein] synthase II  [1] (data from MRSA252)
    SA_RS04845tryptophan--tRNA ligase  [1] (data from MRSA252)
    SA_RS04935hypothetical protein  [1] (data from MRSA252)
    SA_RS05190bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase  [1] (data from MRSA252)
    SA_RS05295phosphocarrier protein HPr  [1] (data from MRSA252)
    SA_RS05300phosphoenolpyruvate--protein phosphotransferase  [1] (data from MRSA252)
    SA_RS05330hypothetical protein  [1] (data from MRSA252)
    SA_RS05350pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SA_RS05355pyruvate dehydrogenase E1 component subunit beta  [1] (data from MRSA252)
    SA_RS05360dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex  [1] (data from MRSA252)
    SA_RS05620thiol reductase thioredoxin  [1] (data from MRSA252)
    SA_RS05860cell division protein FtsZ  [1] (data from MRSA252)
    SA_RS05895isoleucine--tRNA ligase  [1] (data from MRSA252)
    SA_RS05945carbamoyl-phosphate synthase large chain  [1] (data from MRSA252)
    SA_RS06085beta-ketoacyl-ACP reductase  [1] (data from MRSA252)
    SA_RS0614050S ribosomal protein L19  [1] (data from MRSA252)
    SA_RS06165succinyl-CoA ligase subunit beta  [1] (data from MRSA252)
    SA_RS06170succinyl-CoA ligase subunit alpha  [1] (data from MRSA252)
    SA_RS0622530S ribosomal protein S2  [1] (data from MRSA252)
    SA_RS06235elongation factor Ts  [1] (data from MRSA252)
    SA_RS06490glutamine synthetase  [1] (data from MRSA252)
    SA_RS06690transketolase  [1] (data from MRSA252)
    SA_RS06730aconitate hydratase  [1] (data from MRSA252)
    SA_RS06860aminoacyltransferase FemB  [1] (data from MRSA252)
    SA_RS07005cold-shock protein CspA  [1] (data from MRSA252)
    SA_RS070652-oxoglutarate dehydrogenase E1 component  [1] (data from MRSA252)
    SA_RS07360nucleoside-diphosphate kinase  [1] (data from MRSA252)
    SA_RS07385DNA-binding protein HU  [1] (data from MRSA252)
    SA_RS0740030S ribosomal protein S1  [1] (data from MRSA252)
    SA_RS07605phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)  [1] (data from MRSA252)
    SA_RS07695elongation factor P  [1] (data from MRSA252)
    SA_RS07700peptidase M24 family protein  [1] (data from MRSA252)
    SA_RS07730glycine dehydrogenase  [1] (data from MRSA252)
    SA_RS07820superoxide dismutase  [1] (data from MRSA252)
    SA_RS07880glycine--tRNA ligase  [1] (data from MRSA252)
    SA_RS07955molecular chaperone DnaK  [1] (data from MRSA252)
    SA_RS0798530S ribosomal protein S20  [1] (data from MRSA252)
    SA_RS08135hypothetical protein  [1] (data from MRSA252)
    SA_RS0829550S ribosomal protein L21  [1] (data from MRSA252)
    SA_RS08435trigger factor  [1] (data from MRSA252)
    SA_RS08505aldehyde dehydrogenase  [1] (data from MRSA252)
    SA_RS08545isocitrate dehydrogenase (NADP(+))  [1] (data from MRSA252)
    SA_RS08550citrate synthase  [1] (data from MRSA252)
    SA_RS08560pyruvate kinase  [1] (data from MRSA252)
    SA_RS08625universal stress protein UspA  [1] (data from MRSA252)
    SA_RS08630acetate kinase  [1] (data from MRSA252)
    SA_RS0867530S ribosomal protein S4  [1] (data from MRSA252)
    SA_RS08730serine protease  [1] (data from MRSA252)
    SA_RS08760formate--tetrahydrofolate ligase  [1] (data from MRSA252)
    SA_RS08935proline dehydrogenase  [1] (data from MRSA252)
    SA_RS09005transaldolase  [1] (data from MRSA252)
    SA_RS09445glucosamine-6-phosphate isomerase  [1] (data from MRSA252)
    SA_RS09710glutamine amidotransferase  [1] (data from MRSA252)
    SA_RS09810non-heme ferritin  [1] (data from MRSA252)
    SA_RS09860aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C  [1] (data from MRSA252)
    SA_RS10535molecular chaperone GroEL  [1] (data from MRSA252)
    SA_RS11010uracil phosphoribosyltransferase  [1] (data from MRSA252)
    SA_RS11060aldehyde dehydrogenase family protein  [1] (data from MRSA252)
    SA_RS11070UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [1] (data from MRSA252)
    SA_RS11075fructose-bisphosphate aldolase  [1] (data from MRSA252)
    SA_RS11145purine-nucleoside phosphorylase  [1] (data from MRSA252)
    SA_RS11245glutamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    SA_RS11430Asp23/Gls24 family envelope stress response protein  [1] (data from MRSA252)
    SA_RS1160550S ribosomal protein L13  [1] (data from MRSA252)
    SA_RS1163050S ribosomal protein L17  [1] (data from MRSA252)
    SA_RS1164030S ribosomal protein S11  [1] (data from MRSA252)
    SA_RS1167050S ribosomal protein L15  [1] (data from MRSA252)
    SA_RS1168030S ribosomal protein S5  [1] (data from MRSA252)
    SA_RS1170550S ribosomal protein L5  [1] (data from MRSA252)
    SA_RS1173530S ribosomal protein S3  [1] (data from MRSA252)
    SA_RS1174530S ribosomal protein S19  [1] (data from MRSA252)
    SA_RS1175050S ribosomal protein L2  [1] (data from MRSA252)
    SA_RS1175550S ribosomal protein L23  [1] (data from MRSA252)
    SA_RS13340pyruvate oxidase  [1] (data from MRSA252)
    SA_RS13375hydroxymethylglutaryl-CoA synthase  [1] (data from MRSA252)
    SA_RS13730class I fructose-bisphosphate aldolase  [1] (data from MRSA252)
    SA_RS13735malate:quinone oxidoreductase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.159
    • Ymax_pos: 62
    • Cmax: 0.156
    • Cmax_pos: 62
    • Smax: 0.219
    • Smax_pos: 54
    • Smean: 0.139
    • D: 0.151
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 447031784 NCBI
  • RefSeq: WP_001109040 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MNYQALYRMYRPQSFEDVVGQEHVTKTLRNAISKEKQSHAYIFSGPRGTGKTSIAKVFAKAINCLNSTDGEPCNECHICKGITQGTNSDVIEIDAASNNGVDEIRNIRDKVKYAPSESKYKVYIIDEVHMLTTGAFNALLKTLEEPPAHAIFILATTEPHKIPPTIISRAQRFDFKAISLDQIVERLKFVADAQQIECEDEALAFIAKASEGGMRDALSIMDQAIAFGDGTLTLQDALNVTGSVHDEALDHLFDDIVQGDVQASFKKYHQFITEGKEVNRLINDMIYFVRDTIMNKTSEKDTEYRALMNLELDMLYQMIDLINDTLVSIRFSVNQNVHFEVLLVKLAEQIKGQPQVIANVAEPAQIASSPNTDVLLQRMEQLEQELKTLKAQGVSVAPAQKSSKKPARGIQKSKNAFSMQQIAKVLDKANKADIKLLKDHWQEVIDHAKNNDKKSLVSLLQNSEPVAASEDHVLVKFEEEIHCEIVNKDDEKRSSIESVVCNIVNKNVKVVGVPSDQWQRVRTEYLQNRKNEGDDMPKQQAQQTDIAQKAKDLFGEETVHVIDEE

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA_RS02485 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.000 1.001 1.002 1.003 1.004 1.005 1.006 1.007 1.008 1.009 1.010 1.011 1.012 1.013 1.014 1.015 1.016 1.017 1.018 1.019 1.020 1.021 1.022 1.023 1.024 1.025 1.026 1.027 1.028 1.029 1.030 1.031 1.032 1.033 1.034 1.035 1.036 1.037 1.038 1.039 1.040 1.041 1.042 1.043 1.044 1.045 1.046 1.047 1.048 1.049 1.050 1.051 1.052 1.053 1.054 1.055 1.056 1.057 1.058 1.059 1.060 1.061 1.062 1.063 1.064 1.065 1.066 1.067 1.068 1.069 1.070 1.071 1.072 1.073 1.074 1.075 1.076 1.077 1.078 1.079 1.080 1.081 1.082 1.083 1.084 1.085 1.086 1.087 1.088 1.089 1.090 1.091 1.092 1.093 1.094 1.095 1.096 1.097 1.098 1.099 1.100 1.101 1.102 1.103 1.104 1.105 1.106 1.107 1.108 1.109 1.110 1.111 1.112 1.113 1.114 1.115 1.116 1.117 1.118 1.119 1.120 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]