From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_0442 [new locus tag: NWMN_RS02500 ]
  • pan locus tag?: SAUPAN002198000
  • symbol: dnaX
  • pan gene symbol?: dnaX
  • synonym:
  • product: DNA polymerase III gamma subunit

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_0442 [new locus tag: NWMN_RS02500 ]
  • symbol: dnaX
  • product: DNA polymerase III gamma subunit
  • replicon: chromosome
  • strand: +
  • coordinates: 498925..500622
  • length: 1698
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    TTGAATTATCAAGCCTTATATCGTATGTACAGACCCCAAAGTTTCGAGGATGTCGTCGGA
    CAAGAACATGTCACGAAGACATTGCGCAATGCGATTTCGAAAGAAAAACAGTCGCATGCT
    TATATTTTTAGTGGTCCGAGAGGTACGGGGAAAACGAGTATTGCCAAAGTGTTTGCTAAA
    GCAATCAACTGTCTAAATAGCACTGATGGAGAACCTTGTAATGAATGTCATATTTGTAAA
    GGCATTACGCAGGGGACTAATTCAGATGTGATAGAAATTGATGCTGCTAGTAATAATGGC
    GTTGATGAAATAAGAAATATTAGAGACAAAGTTAAATATGCACCAAGTGAATCGAAATAT
    AAAGTTTATATTATAGATGAGGTGCACATGCTAACAACAGGTGCTTTTAATGCCCTTTTA
    AAGACGTTAGAAGAACCTCCAGCACACGCTATTTTTATATTGGCAACGACAGAACCACAT
    AAAATCCCTCCAACAATCATTTCTAGGGCACAACGTTTTGATTTTAAAGCAATTAGCCTA
    GATCAAATTGTTGAACGTTTAAAATTTGTAGCAGATGCACAACAAATTGAATGTGAAGAT
    GAAGCCTTGGCATTTATCGCTAAAGCGTCTGAAGGGGGTATGCGTGATGCATTAAGTATT
    ATGGATCAGGCTATTGCATTTGGTGATGGTACGTTAACATTGCAAGATGCGTTGAATGTC
    ACAGGTAGCGTACATGATGAAGCGTTGGATCACTTGTTTGATGATATTGTACAAGGTGAC
    GTACAAGCATCTTTTAAAAAATACCATCAGTTTATAACAGAAGGTAAAGAAGTGAATCGC
    CTAATAAATGATATGATTTATTTTGTCAGAGATACGATTATGAATAAAACATCTGAGAAA
    GATACTGAGTATCGAGCACTGATGAACTTAGAATTAGATATGTTATATCAAATGATTGAT
    CTTATTAATGATACATTAGTGTCGATTCGTTTTAGTGTGAATCAAAACGTTCATTTTGAA
    GTGTTGTTAGTAAAATTAGCTGAGCAGATTAAGGGTCAACCACAAGTGATTGCGAATGTA
    GCTGAACCAGCACAAATTGCTTCATCGCCAAACACAGATGTATTGTTGCAACGTATGGAA
    CAGTTAGAGCAAGAACTAAAAACACTAAAAGCACAAGGAGTGAGTGTCGCTCCTGTTCAA
    AAATCTTCGAAAAAGCCTGCGAGAGGCATACAAAAATCTAAAAATGCATTTTCAATGCAA
    CAAATTGCAAAAGTGCTAGATAAAGCGAATAAGGCAGATATCAAATTGTTGAAAGATCAT
    TGGCAAGAAGTGATTGATCATGCCAAAAATAATGATAAAAAATCACTCGTTAGTTTATTG
    CAAAATTCGGAACCTGTGGCGGCAAGTGAAGATCACGTACTTGTGAAATTTGAGGAAGAG
    ATCCATTGTGAAATCGTCAATAAAGACGACGAGAAACGTAGTAGTATAGAAAGTGTTGTA
    TGTAATATCGTTAATAAAAACGTTAAAGTTGTTGGTGTACCATCAGATCAATGGCAAAGA
    GTTCGAACGGAATATTTACAAAATCGTAAAAACGAAGGCGATGATATGCCAAAGCAACAA
    GCACAACAAACAGATATTGCTCAAAAAGCAAAAGATCTTTTCGGTGAAGAAACTGTACAT
    GTGATAGATGAAGAGTGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1698

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_0442 [new locus tag: NWMN_RS02500 ]
  • symbol: DnaX
  • description: DNA polymerase III gamma subunit
  • length: 565
  • theoretical pI: 5.32796
  • theoretical MW: 63498.7
  • GRAVY: -0.41823

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA polymerase III, subunit gamma and tau (TIGR02397; EC 2.7.7.7; HMM-score: 461.8)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA polymerase III, delta' subunit (TIGR00678; EC 2.7.7.7; HMM-score: 168.2)
    Cellular processesCellular processesSporulation and germinationATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 41.1)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 41.1)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairHolliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 35)
    Cellular processesCellular processesSporulation and germinationATP-dependent protease, Lon family (TIGR02903; EC 3.4.21.-; HMM-score: 31)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent protease, Lon family (TIGR02903; EC 3.4.21.-; HMM-score: 31)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA polymerase III, delta subunit (TIGR01128; EC 2.7.7.7; HMM-score: 24.9)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype VII secretion AAA-ATPase EccA (TIGR03922; HMM-score: 22)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairorc1/cdc6 family replication initiation protein (TIGR02928; HMM-score: 17.1)
    Cellular processesCellular processesSporulation and germinationstage V sporulation protein K (TIGR02881; HMM-score: 15.6)
  • TheSEED:  
    DNA MetabolismDNA replicationDNA-replication DNA polymerase III subunits gamma and tau (EC 2.7.7.7) 
    DNA uptake, competenceDNA processing cluster DNA polymerase III subunits gamma and tau (EC 2.7.7.7) 
  • PFAM:
    P-loop_NTPase (CL0023) DNA_pol3_delta2; DNA polymerase III, delta subunit (PF13177; HMM-score: 161.9)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 54.2)
    RuvB_N; Holliday junction DNA helicase ruvB N-terminus (PF05496; HMM-score: 33.5)
    TIP49; TIP49 C-terminus (PF06068; HMM-score: 28.6)
    post-AAA (CL0604) DNA_pol3_gamma3; DNA polymerase III subunits gamma and tau domain III (PF12169; HMM-score: 24.3)
    P-loop_NTPase (CL0023) AAA_16; AAA ATPase domain (PF13191; HMM-score: 24.3)
    AAA_30; AAA domain (PF13604; HMM-score: 22.8)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 22.5)
    AAA_19; AAA domain (PF13245; HMM-score: 20.5)
    PIF1; PIF1-like helicase (PF05970; HMM-score: 20.4)
    AAA_14; AAA domain (PF13173; HMM-score: 20)
    AAA_22; AAA domain (PF13401; HMM-score: 20)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 18.8)
    AAA_18; AAA domain (PF13238; HMM-score: 18.4)
    TniB; Bacterial TniB protein (PF05621; HMM-score: 17.7)
    ResIII; Type III restriction enzyme, res subunit (PF04851; HMM-score: 17.3)
    no clan definedAAA_assoc_2; AAA C-terminal domain (PF16193; HMM-score: 17.1)
    P-loop_NTPase (CL0023) AAA_24; AAA domain (PF13479; HMM-score: 16.9)
    T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 14.4)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 12.6)
    no clan definedCom_YlbF; Control of competence regulator ComK, YlbF/YmcA (PF06133; HMM-score: 7.5)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    NWMN_1605(ackA)acetate kinase  [1] (data from MRSA252)
    NWMN_0372(ahpC)alkyl hydroperoxide reductase subunit C  [1] (data from MRSA252)
    NWMN_1114(carB)carbamoyl phosphate synthase large subunit  [1] (data from MRSA252)
    NWMN_1587(citC)isocitrate dehydrogenase  [1] (data from MRSA252)
    NWMN_1588(citZ)citrate synthase  [1] (data from MRSA252)
    NWMN_1313(cspA)major cold-shock protein CspA  [1] (data from MRSA252)
    NWMN_2042(deoD)purine nucleoside phosphorylase  [1] (data from MRSA252)
    NWMN_0805(dltC)D-alanine--poly(phosphoribitol) ligase subunit 2  [1] (data from MRSA252)
    NWMN_1483(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    NWMN_0002(dnaN)DNA polymerase III subunit beta  [1] (data from MRSA252)
    NWMN_1433(efp)elongation factor P  [1] (data from MRSA252)
    NWMN_0745(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    NWMN_0551(eutD)phosphotransacetylase  [1] (data from MRSA252)
    NWMN_1141(fabG)3-oxoacyl-[acyl-carrier protein] reductase  [1] (data from MRSA252)
    NWMN_2029(fbaA)fructose-bisphosphate aldolase  [1] (data from MRSA252)
    NWMN_1287(femB)methicillin resistance expression factor FemB  [1] (data from MRSA252)
    NWMN_1625(fhs)formate--tetrahydrofolate ligase  [1] (data from MRSA252)
    NWMN_0932(folD)bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase  [1] (data from MRSA252)
    NWMN_1096(ftsZ)cell division protein FtsZ  [1] (data from MRSA252)
    NWMN_0509(fus)elongation factor G  [1] (data from MRSA252)
    NWMN_0741(gapA)glyceraldehyde 3-phosphate dehydrogenase 1  [1] (data from MRSA252)
    NWMN_1580(gapB)glyceraldehyde 3-phosphate dehydrogenase 2  [1] (data from MRSA252)
    NWMN_1839(gatC)aspartyl/glutamyl-tRNA amidotransferase subunit C  [1] (data from MRSA252)
    NWMN_1440(gcvPA)glycine dehydrogenase subunit 1  [1] (data from MRSA252)
    NWMN_2056(glmS)glucosamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    NWMN_1217(glnA)glutamine synthetase  [1] (data from MRSA252)
    NWMN_0490(gltX)glutamyl-tRNA synthetase  [1] (data from MRSA252)
    NWMN_1468(glyS)glycyl-tRNA synthetase  [1] (data from MRSA252)
    NWMN_1417(gnd)6-phosphogluconate dehydrogenase  [1] (data from MRSA252)
    NWMN_1937(groEL)chaperonin GroEL  [1] (data from MRSA252)
    NWMN_0380(guaB)inosine-5'-monophosphate dehydrogenase  [1] (data from MRSA252)
    NWMN_1103(ileS)isoleucyl-tRNA synthetase  [1] (data from MRSA252)
    NWMN_0516(ilvE)branched-chain amino acid aminotransferase  [1] (data from MRSA252)
    NWMN_2028(murZ)UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [1] (data from MRSA252)
    NWMN_2446(mvaS)3-hydroxy-3-methylglutaryl coenzyme A synthase  [1] (data from MRSA252)
    NWMN_1378(ndk)nucleoside diphosphate kinase  [1] (data from MRSA252)
    NWMN_1176(nusA)transcription elongation factor NusA  [1] (data from MRSA252)
    NWMN_0498(nusG)transcription antitermination protein  [1] (data from MRSA252)
    NWMN_0961(pdhC)branched-chain alpha-keto acid dehydrogenase subunit E2  [1] (data from MRSA252)
    NWMN_0162(pflB)formate acetyltransferase  [1] (data from MRSA252)
    NWMN_0833(pgi)glucose-6-phosphate isomerase  [1] (data from MRSA252)
    NWMN_0742(pgk)phosphoglycerate kinase  [1] (data from MRSA252)
    NWMN_0744(pgm)phosphoglyceromutase  [1] (data from MRSA252)
    NWMN_0959(phdA)pyruvate dehydrogenase E1 component, alpha subunit  [1] (data from MRSA252)
    NWMN_0960(phdB)pyruvate dehydrogenase E1 component, beta subunit  [1] (data from MRSA252)
    NWMN_1174(polC)DNA polymerase III PolC  [1] (data from MRSA252)
    NWMN_2438(poxB)pyruvate oxidase  [1] (data from MRSA252)
    NWMN_0463(prs)ribose-phosphate pyrophosphokinase  [1] (data from MRSA252)
    NWMN_1658(putA)proline dehydrogenase  [1] (data from MRSA252)
    NWMN_1592(pykA)pyruvate kinase  [1] (data from MRSA252)
    NWMN_0500(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    NWMN_2149(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    NWMN_2140(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    NWMN_0501(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    NWMN_0502(rplL)50S ribosomal protein L7/L12  [1] (data from MRSA252)
    NWMN_2120(rplM)50S ribosomal protein L13  [1] (data from MRSA252)
    NWMN_2133(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    NWMN_2125(rplQ)50S ribosomal protein L17  [1] (data from MRSA252)
    NWMN_1151(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    NWMN_1549(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    NWMN_2150(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    NWMN_0464(rplY)50S ribosomal protein L25/general stress protein Ctc  [1] (data from MRSA252)
    NWMN_0504(rpoB)DNA-directed RNA polymerase subunit beta  [1] (data from MRSA252)
    NWMN_0505(rpoC)DNA-directed RNA polymerase subunit beta'  [1] (data from MRSA252)
    NWMN_1385(rpsA)30S ribosomal protein S1  [1] (data from MRSA252)
    NWMN_1166(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    NWMN_2146(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    NWMN_1613(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    NWMN_2135(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    NWMN_0508(rpsG)30S ribosomal protein S7  [1] (data from MRSA252)
    NWMN_2127(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    NWMN_2148(rpsS)30S ribosomal protein S19  [1] (data from MRSA252)
    NWMN_1488(rpsT)30S ribosomal protein S20  [1] (data from MRSA252)
    NWMN_1456(sodA)superoxide dismutase Mn/Fe family protein  [1] (data from MRSA252)
    NWMN_0055(spa)immunoglobulin G binding protein A precursor (protein A)  [1] (data from MRSA252)
    NWMN_1326(sucA)2-oxoglutarate dehydrogenase E1 component  [1] (data from MRSA252)
    NWMN_1155(sucC)succinyl-CoA synthetase subunit beta  [1] (data from MRSA252)
    NWMN_1156(sucD)succinyl-CoA synthetase subunit alpha  [1] (data from MRSA252)
    NWMN_1569(tig)trigger factor  [1] (data from MRSA252)
    NWMN_1254(tkt)transketolase  [1] (data from MRSA252)
    NWMN_0743(tpiA)triosephosphate isomerase  [1] (data from MRSA252)
    NWMN_0866(trpS)tryptophanyl-tRNA synthetase  [1] (data from MRSA252)
    NWMN_1057(trxA)thioredoxin  [1] (data from MRSA252)
    NWMN_0732(trxB)thioredoxin reductase  [1] (data from MRSA252)
    NWMN_1167(tsf)elongation factor Ts  [1] (data from MRSA252)
    NWMN_0510(tufA)elongation factor Tu  [1] (data from MRSA252)
    NWMN_2016(upp)uracil phosphoribosyltransferase  [1] (data from MRSA252)
    NWMN_0346acetyl-CoA acetyltransferase  [1] (data from MRSA252)
    NWMN_0358single-strand DNA-binding family protein  [1] (data from MRSA252)
    NWMN_0375hypothetical protein  [1] (data from MRSA252)
    NWMN_0443hypothetical protein  [1] (data from MRSA252)
    NWMN_0475cysteine synthase-like protein  [1] (data from MRSA252)
    NWMN_0481pyridoxal biosynthesis lyase PdxS  [1] (data from MRSA252)
    NWMN_0533hypothetical protein  [1] (data from MRSA252)
    NWMN_0632hypothetical protein  [1] (data from MRSA252)
    NWMN_0638hypothetical protein  [1] (data from MRSA252)
    NWMN_0641hypothetical protein  [1] (data from MRSA252)
    NWMN_0651hypothetical protein  [1] (data from MRSA252)
    NWMN_0721sigma 54 modulation protein  [1] (data from MRSA252)
    NWMN_0776glycine cleavage system protein H  [1] (data from MRSA252)
    NWMN_0811hypothetical protein  [1] (data from MRSA252)
    NWMN_08543-oxoacyl-(acyl-carrier-protein) synthase II  [1] (data from MRSA252)
    NWMN_0885hypothetical protein  [1] (data from MRSA252)
    NWMN_0949phosphocarrier protein HPr  [1] (data from MRSA252)
    NWMN_0950phosphoenolpyruvate-protein phosphatase  [1] (data from MRSA252)
    NWMN_1263aconitate hydratase  [1] (data from MRSA252)
    NWMN_1382DNA-binding protein HU  [1] (data from MRSA252)
    NWMN_1434proline dipeptidase  [1] (data from MRSA252)
    NWMN_1516hypothetical protein  [1] (data from MRSA252)
    NWMN_1604universal stress protein family protein  [1] (data from MRSA252)
    NWMN_1621hypothetical protein  [1] (data from MRSA252)
    NWMN_1672putative translaldolase  [1] (data from MRSA252)
    NWMN_1746hypothetical protein  [1] (data from MRSA252)
    NWMN_1767ThiJ/PfpI family protein  [1] (data from MRSA252)
    NWMN_1831ferritin  [1] (data from MRSA252)
    NWMN_2026aldehyde dehydrogenase family protein  [1] (data from MRSA252)
    NWMN_2086alkaline shock protein 23  [1] (data from MRSA252)
    NWMN_2503fructose-1,6-bisphosphate aldolase  [1] (data from MRSA252)
    NWMN_2504malate:quinone oxidoreductase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.159
    • Ymax_pos: 62
    • Cmax: 0.156
    • Cmax_pos: 62
    • Smax: 0.219
    • Smax_pos: 54
    • Smean: 0.139
    • D: 0.151
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MNYQALYRMYRPQSFEDVVGQEHVTKTLRNAISKEKQSHAYIFSGPRGTGKTSIAKVFAKAINCLNSTDGEPCNECHICKGITQGTNSDVIEIDAASNNGVDEIRNIRDKVKYAPSESKYKVYIIDEVHMLTTGAFNALLKTLEEPPAHAIFILATTEPHKIPPTIISRAQRFDFKAISLDQIVERLKFVADAQQIECEDEALAFIAKASEGGMRDALSIMDQAIAFGDGTLTLQDALNVTGSVHDEALDHLFDDIVQGDVQASFKKYHQFITEGKEVNRLINDMIYFVRDTIMNKTSEKDTEYRALMNLELDMLYQMIDLINDTLVSIRFSVNQNVHFEVLLVKLAEQIKGQPQVIANVAEPAQIASSPNTDVLLQRMEQLEQELKTLKAQGVSVAPVQKSSKKPARGIQKSKNAFSMQQIAKVLDKANKADIKLLKDHWQEVIDHAKNNDKKSLVSLLQNSEPVAASEDHVLVKFEEEIHCEIVNKDDEKRSSIESVVCNIVNKNVKVVGVPSDQWQRVRTEYLQNRKNEGDDMPKQQAQQTDIAQKAKDLFGEETVHVIDEE

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.000 1.001 1.002 1.003 1.004 1.005 1.006 1.007 1.008 1.009 1.010 1.011 1.012 1.013 1.014 1.015 1.016 1.017 1.018 1.019 1.020 1.021 1.022 1.023 1.024 1.025 1.026 1.027 1.028 1.029 1.030 1.031 1.032 1.033 1.034 1.035 1.036 1.037 1.038 1.039 1.040 1.041 1.042 1.043 1.044 1.045 1.046 1.047 1.048 1.049 1.050 1.051 1.052 1.053 1.054 1.055 1.056 1.057 1.058 1.059 1.060 1.061 1.062 1.063 1.064 1.065 1.066 1.067 1.068 1.069 1.070 1.071 1.072 1.073 1.074 1.075 1.076 1.077 1.078 1.079 1.080 1.081 1.082 1.083 1.084 1.085 1.086 1.087 1.088 1.089 1.090 1.091 1.092 1.093 1.094 1.095 1.096 1.097 1.098 1.099 1.100 1.101 1.102 1.103 1.104 1.105 1.106 1.107 1.108 1.109 1.110 1.111 1.112 1.113 1.114 1.115 1.116 1.117 1.118 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]