From AureoWiki
Jump to: navigation, search
NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_00832
  • pan locus tag?: SAUPAN002817000
  • symbol: SAOUHSC_00832
  • pan gene symbol?: aroD
  • synonym:
  • product: 3-dehydroquinase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_00832
  • symbol: SAOUHSC_00832
  • product: 3-dehydroquinase
  • replicon: chromosome
  • strand: +
  • coordinates: 807550..808266
  • length: 717
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGACACATGTGGAAGTAGTAGCGACTATCGCGCCACAATTATCTATCGAAGAAACTTTA
    ATTCAAAAAATTAATCATCGTATTGATGCAATAGACGTATTAGAATTACGAATTGATCAA
    ATTGAAAATGTCACAGTTGATCAAGTGGCAGAAATGATTACAAAGCTGAAGGTTATGCAA
    GATTCATTCAAATTATTAGTTACGTATCGTACAAAGTTACAAGGTGGCTATGGGCAATTT
    ACAAATGACTCGTATCTTAATTTAATATCAGACTTAGCAAATATCAATGGCATAGATATG
    ATTGATATAGAATGGCAAGCAGATATTGACATTGAAAAACATCAACGAATCATTACACAT
    TTGCAACAGTATAATAAAGAGGTGGTTATATCACATCATAATTTCGAAAGTACGCCTCCA
    TTAGATGAATTGCAATTTATATTTTTTAAAATGCAAAAATTCAACCCAGAATACGTTAAA
    TTAGCAGTAATGCCACATAATAAAAATGATGTGTTAAATTTATTGCAGGCAATGTCTACA
    TTTTCAGATACTATGGACTGCAAAGTTGTTGGTATTTCAATGTCTAAACTTGGACTAATA
    AGTAGAACGGCTCAAGGCGTTTTTGGTGGTGCGTTGACTTATGGTTGTATCGGAGTACCA
    CAAGCTCCAGGACAGATTGATGTTACTGATTTAAAAGCACAAGTGACTTTATACTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    717

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAOUHSC_00832
  • symbol: SAOUHSC_00832
  • description: 3-dehydroquinase
  • length: 238
  • theoretical pI: 4.90902
  • theoretical MW: 26868.8
  • GRAVY: -0.0155462

Function[edit source | edit]

  • reaction:
    EC 4.2.1.10?  ExPASy
    3-dehydroquinate dehydratase3-dehydroquinate = 3-dehydroshikimate + H2O
  • TIGRFAM:
    MetabolismAmino acid biosynthesisAromatic amino acid family3-dehydroquinate dehydratase, type I (TIGR01093; EC 4.2.1.10; HMM-score: 173.2)
  • TheSEED:  
    Amino Acids and DerivativesAromatic amino acids and derivativesChorismate Synthesis 3-dehydroquinate dehydratase I (EC 4.2.1.10) 
    Aromatic amino acids and derivativesCommon Pathway For Synthesis of Aromatic Compounds (DAHP synthase to chorismate) 3-dehydroquinate dehydratase I (EC 4.2.1.10) 
    Metabolism of Aromatic CompoundsPeripheral pathways for catabolism of aromatic compoundsQuinate degradation 3-dehydroquinate dehydratase I (EC 4.2.1.10) 
  • PFAM:
    TIM_barrel (CL0036) DHquinase_I; Type I 3-dehydroquinase (PF01487; HMM-score: 165)
    no clan definedBorrelia_lipo_2; Borrelia burgdorferi BBR25 lipoprotein (PF06238; HMM-score: 10.4)

Structure, modifications & interactions[edit source | edit]

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.104
    • Ymax_pos: 28
    • Cmax: 0.115
    • Cmax_pos: 24
    • Smax: 0.122
    • Smax_pos: 19
    • Smean: 0.086
    • D: 0.097
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MTHVEVVATIAPQLSIEETLIQKINHRIDAIDVLELRIDQIENVTVDQVAEMITKLKVMQDSFKLLVTYRTKLQGGYGQFTNDSYLNLISDLANINGIDMIDIEWQADIDIEKHQRIITHLQQYNKEVVISHHNFESTPPLDELQFIFFKMQKFNPEYVKLAVMPHNKNDVLNLLQAMSTFSDTMDCKVVGISMSKLGLISRTAQGVFGGALTYGCIGVPQAPGQIDVTDLKAQVTLY

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.000 1.001 1.002 1.003 1.004 1.005 1.006 1.007 1.008 1.009 1.010 1.011 1.012 1.013 1.014 1.015 1.016 1.017 1.018 1.019 1.020 1.021 1.022 1.023 1.024 1.025 1.026 1.027 1.028 1.029 1.030 1.031 1.032 1.033 1.034 1.035 1.036 1.037 1.038 1.039 1.040 1.041 1.042 1.043 1.044 1.045 1.046 1.047 1.048 1.049 1.050 1.051 1.052 1.053 1.054 1.055 1.056 1.057 1.058 1.059 1.060 1.061 1.062 1.063 1.064 1.065 1.066 1.067 1.068 1.069 1.070 1.071 1.072 1.073 1.074 1.075 1.076 1.077 1.078 1.079 1.080 1.081 1.082 1.083 1.084 1.085 1.086 1.087 1.088 1.089 1.090 1.091 1.092 1.093 1.094 1.095 1.096 1.097 1.098 1.099 1.100 1.101 1.102 1.103 1.104 1.105 1.106

Relevant publications[edit source | edit]