From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0448 [new locus tag: SA_RS02585 ]
  • pan locus tag?: SAUPAN002227000
  • symbol: metS
  • pan gene symbol?: metS
  • synonym:
  • product: methionyl-tRNA synthetase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA0448 [new locus tag: SA_RS02585 ]
  • symbol: metS
  • product: methionyl-tRNA synthetase
  • replicon: chromosome
  • strand: +
  • coordinates: 519188..521161
  • length: 1974
  • essential: yes [1] DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    ATGGCTAAAGAAACATTTTATATAACAACCCCAATATACTATCCTAGTGGGAATTTACAT
    ATAGGACATGCATATTCTACAGTGGCTGGAGATGTTATTGCAAGATATAAGAGAATGCAA
    GGATATGATGTTCGTTATTTGACTGGAACGGATGAACACGGTCAAAAAATTCAAGAAAAA
    GCTCAAAAAGCTGGTAAGACAGAAATTGAATATTTGGATGAGATGATTGCTGGAATTAAA
    CAATTGTGGGCTAAGCTTGAAATTTCAAATGATGATTTTATCAGAACAACTGAAGAACGT
    CATAAACATGTCGTTGAGCAAGTGTTTGAACGTTTATTAAAGCAAGGTGATATCTATTTA
    GGTGAATATGAAGGTTGGTATTCTGTTCCGGATGAAACATACTATACAGAGTCACAATTA
    GTAGACCCACAATACGAAAACGGTAAAATTATTGGTGGCAAAAGTCCAGATTCTGGACAC
    GAAGTTGAACTAGTTAAAGAAGAAAGTTATTTCTTTAATATTAGTAAATATACAGACCGT
    TTATTAGAGTTCTATGACCAAAATCCAGATTTTATACAACCACCATCAAGAAAAAATGAA
    ATGATTAACAACTTCATTAAACCAGGACTTGCTGATTTAGCTGTTTCTCGTACATCATTT
    AACTGGGGTGTCCATGTTCCGTCTAATCCAAAACATGTTGTTTATGTTTGGATTGATGCG
    TTAGTTAACTATATTTCAGCATTAGGCTATTTATCAGATGATGAGTCACTATTTAACAAA
    TACTGGCCAGCAGATATTCATTTAATGGCTAAGGAAATTGTGCGATTCCACTCAATTATT
    TGGCCTATTTTATTGATGGCATTAGACTTACCGTTACCTAAAAAAGTCTTTGCACATGGT
    TGGATTTTGATGAAAGATGGAAAAATGAGTAAATCTAAAGGTAATGTTGTAGACCCTAAT
    ATTTTAATTGATCGCTATGGTTTAGATGCTACACGTTATTATCTAATGCGTGAATTACCA
    TTTGGTTCAGATGGCGTATTTACACCTGAAGCATTTGTTGAGCGTACAAATTTCGATCTA
    GCAAATGACTTAGGTAACTTAGTAAACCGTACGATTTCTATGGTTAATAAGTACTTTGAT
    GGCGAATTACCAGCGTATCAAGGTCCACTTCATGAATTAGATGAAGAAATGGAAGCTATG
    GCTTTAGAAACAGTGAAAAGCTACACTGAAAGCATGGAAAGTTTGCAATTTTCTGTGGCA
    TTATCTACGGTATGGAAGTTTATAAGTAGAACGAATAAGTATATTGACGAAACAACGCCT
    TGGGTATTAGCTAAGGACGATAGCCAAAAAGATATGTTAGGCAATGTAATGGCTCACTTA
    GTTGAAAATATTCGTTATGCAGCTGTATTATTACGTCCATTCTTAACACATGCGCCGAAA
    GAGATTTTTGAACAATTGAACATAAACAATCCTCAATTTATGGAATTTAGTAGTTTAGAG
    CAATATGGTGTGCTTACTGAGTCAATTATGGTTACTGGGCAACCTAAACCTATTTTCCCA
    AGATTGGATAGCGAAGCGGAAATTGCATATATCAAAGAATCAATGCAACCGCCTGCTACT
    GAAGAGGAAAAAGAAGAGATTCCTAGCAAACCTCAAATTGATATTAAAGACTTTGATAAA
    GTTGAAATTAAGGCAGCAACGATTATTGATGCTGAACATGTTAAGAAGTCAGATAAGCTT
    TTAAAAATTCAAGTAGACTTAGATTCTGAACAAAGACAAATTGTATCAGGAATTGCCAAA
    TTCTATACACCAGATGATATTATTGGTAAAAAAGTAGCAGTTGTTACTAACCTGAAACCA
    GCTAAATTAATGGGACAAAAATCTGAAGGTATGATATTATCTGCTGAAAAAGATGGTGTA
    TTAACCTTAGTAAGTTTACCAAGTGCAATTCCAAATGGTGCAGTGATTAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1974

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA0448 [new locus tag: SA_RS02585 ]
  • symbol: MetS
  • description: methionyl-tRNA synthetase
  • length: 657
  • theoretical pI: 4.86419
  • theoretical MW: 74872.9
  • GRAVY: -0.33379

Function[edit source | edit]

  • reaction:
    EC 6.1.1.10?  ExPASy
    Methionine--tRNA ligaseATP + L-methionine + tRNA(Met) = AMP + diphosphate + L-methionyl-tRNA(Met)
  • TIGRFAM:
    Genetic information processingProtein synthesistRNA aminoacylationmethionine--tRNA ligase (TIGR00398; EC 6.1.1.10; HMM-score: 564.5)
    Genetic information processingProtein synthesistRNA aminoacylationvaline--tRNA ligase (TIGR00422; EC 6.1.1.9; HMM-score: 148.9)
    Genetic information processingProtein synthesistRNA aminoacylationmethionine--tRNA ligase, beta subunit (TIGR00399; EC 6.1.1.10; HMM-score: 139.1)
    Genetic information processingProtein synthesistRNA aminoacylationleucine--tRNA ligase (TIGR00396; EC 6.1.1.4; HMM-score: 114.4)
    Genetic information processingProtein synthesistRNA aminoacylationisoleucine--tRNA ligase (TIGR00392; EC 6.1.1.5; HMM-score: 112)
    Genetic information processingProtein synthesistRNA aminoacylationleucine--tRNA ligase (TIGR00395; EC 6.1.1.4; HMM-score: 81.2)
    Genetic information processingProtein synthesistRNA aminoacylationcysteine--tRNA ligase (TIGR00435; EC 6.1.1.16; HMM-score: 62)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingexport-related chaperone protein CsaA (TIGR02222; HMM-score: 38.7)
    Genetic information processingProtein fateProtein folding and stabilizationexport-related chaperone protein CsaA (TIGR02222; HMM-score: 38.7)
    Genetic information processingProtein synthesistRNA aminoacylationphenylalanine--tRNA ligase, beta subunit (TIGR00472; EC 6.1.1.20; HMM-score: 27.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersGlutathione and analogscysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase (TIGR03447; EC 6.3.1.13; HMM-score: 26.2)
    Genetic information processingProtein synthesistRNA aminoacylationarginine--tRNA ligase (TIGR00456; EC 6.1.1.19; HMM-score: 24)
    Genetic information processingProtein synthesistRNA aminoacylationlysine--tRNA ligase (TIGR00467; EC 6.1.1.6; HMM-score: 16.4)
  • TheSEED:  
    Methionyl-tRNA synthetase (EC 6.1.1.10) 
  • PFAM:
    HUP (CL0039) tRNA-synt_1g; tRNA synthetases class I (M) (PF09334; HMM-score: 387.2)
    tRNA-synt_1; tRNA synthetases class I (I, L, M and V) (PF00133; HMM-score: 105.5)
    OB (CL0021) tRNA_bind; Putative tRNA binding domain (PF01588; HMM-score: 89.1)
    HUP (CL0039) tRNA-synt_1e; tRNA synthetases class I (C) catalytic domain (PF01406; HMM-score: 56.5)
    DALR (CL0258) Anticodon_1; Anticodon-binding domain of tRNA (PF08264; HMM-score: 35.3)
    HUP (CL0039) tRNA-synt_1f; tRNA synthetases class I (K) (PF01921; HMM-score: 25.3)
    Pilus (CL0327) PilM; PilM (PF07419; HMM-score: 14.6)
    no clan definedARL2_Bind_BART; The ARF-like 2 binding protein BART (PF11527; HMM-score: 13)
    HUP (CL0039) tRNA-synt_1d; tRNA synthetases class I (R) (PF00750; HMM-score: 12.6)
    no clan definedT4_neck-protein; Virus neck protein (PF11649; HMM-score: 10.8)
    HUP (CL0039) tRNA-synt_1c; tRNA synthetases class I (E and Q), catalytic domain (PF00749; HMM-score: 9.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA0033(aadD)kanamycin nucleotidyltransferase  [2] (data from MRSA252)
    SA1533(ackA)acetate kinase  [2] (data from MRSA252)
    SA2027(adk)adenylate kinase  [2] (data from MRSA252)
    SA0366(ahpC)alkyl hydroperoxide reductase  [2] (data from MRSA252)
    SA2428(arcA)arginine deiminase  [2] (data from MRSA252)
    SA2427(arcB)ornithine carbamoyltransferase  [2] (data from MRSA252)
    SA1984(asp23)alkaline shock protein 23  [2] (data from MRSA252)
    SA1184(citB)aconitate hydratase  [2] (data from MRSA252)
    SA1517(citC)isocitrate dehydrogenase  [2] (data from MRSA252)
    SA0471(cysK)hypothetical protein  [2] (data from MRSA252)
    SA2312(ddh)D-lactate dehydrogenase  [2] (data from MRSA252)
    SA1940(deoD)purine nucleoside phosphorylase  [2] (data from MRSA252)
    SA1409(dnaK)molecular chaperone DnaK  [2] (data from MRSA252)
    SA0731(eno)phosphopyruvate hydratase  [2] (data from MRSA252)
    SA0545(eutD)phosphotransacetylase  [2] (data from MRSA252)
    SA1901(fabZ)(3R)-hydroxymyristoyl-ACP dehydratase  [2] (data from MRSA252)
    SA1927(fbaA)fructose-bisphosphate aldolase  [2] (data from MRSA252)
    SA1553(fhs)formate--tetrahydrofolate ligase  [2] (data from MRSA252)
    SA1029(ftsZ)cell division protein FtsZ  [2] (data from MRSA252)
    SA0505(fus)elongation factor G  [2] (data from MRSA252)
    SA0727(gap)glyceraldehyde-3-phosphate dehydrogenase  [2] (data from MRSA252)
    SA1510(gapB)glyceraldehyde 3-phosphate dehydrogenase 2  [2] (data from MRSA252)
    SA1716(gatA)aspartyl/glutamyl-tRNA amidotransferase subunit A  [2] (data from MRSA252)
    SA1959(glmS)glucosamine--fructose-6-phosphate aminotransferase  [2] (data from MRSA252)
    SA1150(glnA)glutamine-ammonia ligase  [2] (data from MRSA252)
    SA1342(gnd)6-phosphogluconate dehydrogenase  [2] (data from MRSA252)
    SA2204(gpmA)phosphoglyceromutase  [2] (data from MRSA252)
    SA1836(groEL)molecular chaperone GroEL  [2] (data from MRSA252)
    SA0375(guaB)inositol-monophosphate dehydrogenase  [2] (data from MRSA252)
    SA0819(gudB)NAD-specific glutamate dehydrogenase  [2] (data from MRSA252)
    SA1305(hu)DNA-binding protein II  [2] (data from MRSA252)
    SA0232(lctE)L-lactate dehydrogenase  [2] (data from MRSA252)
    SA2400(mqo2)malate:quinone oxidoreductase  [2] (data from MRSA252)
    SA2334(mvaS)3-hydroxy-3-methylglutaryl-CoA synthase  [2] (data from MRSA252)
    SA1301(ndk)nucleoside diphosphate kinase  [2] (data from MRSA252)
    SA1244(odhB)dihydrolipoamide succinyltransferase  [2] (data from MRSA252)
    SA0943-1(pdhA)pyruvate dehydrogenase E1 component subunit alpha  [2] (data from MRSA252)
    SA0946(pdhD)dihydrolipoamide dehydrogenase  [2] (data from MRSA252)
    SA1938(pdp)pyrimidine-nucleoside phosphorylase  [2] (data from MRSA252)
    SA1521(pfkA)6-phosphofructokinase  [2] (data from MRSA252)
    SA0218(pflB)formate acetyltransferase  [2] (data from MRSA252)
    SA0823(pgi)glucose-6-phosphate isomerase  [2] (data from MRSA252)
    SA0728(pgk)phosphoglycerate kinase  [2] (data from MRSA252)
    SA0730(pgm)phosphoglyceromutase  [2] (data from MRSA252)
    SA0458(prs)ribose-phosphate pyrophosphokinase  [2] (data from MRSA252)
    SA1520(pykA)pyruvate kinase  [2] (data from MRSA252)
    SA2341(rocA)1-pyrroline-5-carboxylate dehydrogenase  [2] (data from MRSA252)
    SA0496(rplA)50S ribosomal protein L1  [2] (data from MRSA252)
    SA2044(rplB)50S ribosomal protein L2  [2] (data from MRSA252)
    SA2047(rplC)50S ribosomal protein L3  [2] (data from MRSA252)
    SA2046(rplD)50S ribosomal protein L4  [2] (data from MRSA252)
    SA2035(rplE)50S ribosomal protein L5  [2] (data from MRSA252)
    SA2033(rplF)50S ribosomal protein L6  [2] (data from MRSA252)
    SA0014(rplI)50S ribosomal protein L9  [2] (data from MRSA252)
    SA0497(rplJ)50S ribosomal protein L10  [2] (data from MRSA252)
    SA0495(rplK)50S ribosomal protein L11  [2] (data from MRSA252)
    SA2017(rplM)50S ribosomal protein L13  [2] (data from MRSA252)
    SA2022(rplQ)50S ribosomal protein L17  [2] (data from MRSA252)
    SA1084(rplS)50S ribosomal protein L19  [2] (data from MRSA252)
    SA2042(rplV)50S ribosomal protein L22  [2] (data from MRSA252)
    SA2045(rplW)50S ribosomal protein L23  [2] (data from MRSA252)
    SA2036(rplX)50S ribosomal protein L24  [2] (data from MRSA252)
    SA0459(rplY)50S ribosomal protein L25  [2] (data from MRSA252)
    SA1922(rpmE2)50S ribosomal protein L31  [2] (data from MRSA252)
    SA0501(rpoC)DNA-directed RNA polymerase subunit beta'  [2] (data from MRSA252)
    SA1308(rpsA)30S ribosomal protein S1  [2] (data from MRSA252)
    SA1099(rpsB)30S ribosomal protein S2  [2] (data from MRSA252)
    SA2041(rpsC)30S ribosomal protein S3  [2] (data from MRSA252)
    SAS052(rpsD)30S ribosomal protein S4  [2] (data from MRSA252)
    SA2031(rpsE)30S ribosomal protein S5  [2] (data from MRSA252)
    SA0352(rpsF)30S ribosomal protein S6  [2] (data from MRSA252)
    SA0504(rpsG)30S ribosomal protein S7  [2] (data from MRSA252)
    SA2034(rpsH)30S ribosomal protein S8  [2] (data from MRSA252)
    SA2016(rpsI)30S ribosomal protein S9  [2] (data from MRSA252)
    SA2048(rpsJ)30S ribosomal protein S10  [2] (data from MRSA252)
    SA2024(rpsK)30S ribosomal protein S11  [2] (data from MRSA252)
    SA2025(rpsM)30S ribosomal protein S13  [2] (data from MRSA252)
    SA1116(rpsO)30S ribosomal protein S15  [2] (data from MRSA252)
    SA1081(rpsP)30S ribosomal protein S16  [2] (data from MRSA252)
    SA2038(rpsQ)30S ribosomal protein S17  [2] (data from MRSA252)
    SA0354(rpsR)30S ribosomal protein S18  [2] (data from MRSA252)
    SA2043(rpsS)30S ribosomal protein S19  [2] (data from MRSA252)
    SA1414(rpsT)30S ribosomal protein S20  [2] (data from MRSA252)
    SA0009(serS)seryl-tRNA synthetase  [2] (data from MRSA252)
    SA1382(sodA)superoxide dismutase SodA  [2] (data from MRSA252)
    SA1245(sucA)2-oxoglutarate dehydrogenase E1  [2] (data from MRSA252)
    SA1088(sucC)succinyl-CoA synthetase subunit beta  [2] (data from MRSA252)
    SA1089(sucD)succinyl-CoA synthetase subunit alpha  [2] (data from MRSA252)
    SA1499(tig)trigger factor  [2] (data from MRSA252)
    SA1177(tkt)transketolase  [2] (data from MRSA252)
    SA0729(tpiA)triosephosphate isomerase  [2] (data from MRSA252)
    SA0992(trxA)thioredoxin  [2] (data from MRSA252)
    SA1100(tsf)elongation factor Ts  [2] (data from MRSA252)
    SA0506(tuf)elongation factor Tu  [2] (data from MRSA252)
    SA0342hypothetical protein  [2] (data from MRSA252)
    SA0422hypothetical protein  [2] (data from MRSA252)
    SA0437hypothetical protein  [2] (data from MRSA252)
    SA0477pyridoxal biosynthesis lyase PdxS  [2] (data from MRSA252)
    SA0587hypothetical protein  [2] (data from MRSA252)
    SA0802hypothetical protein  [2] (data from MRSA252)
    SA0829hypothetical protein  [2] (data from MRSA252)
    SA0859hypothetical protein  [2] (data from MRSA252)
    SA1255PTS system glucose-specific transporter subunit enzyme II A  [2] (data from MRSA252)
    SA1528hypothetical protein  [2] (data from MRSA252)
    SA1599translaldolase  [2] (data from MRSA252)
    SA1709hypothetical protein  [2] (data from MRSA252)
    SA2098glycerate dehydrogenase  [2] (data from MRSA252)
    SA2395L-lactate dehydrogenase  [2] (data from MRSA252)
    SA2399fructose-1,6-bisphosphate aldolase  [2] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.129
    • Ymax_pos: 25
    • Cmax: 0.19
    • Cmax_pos: 35
    • Smax: 0.15
    • Smax_pos: 23
    • Smean: 0.093
    • D: 0.115
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MAKETFYITTPIYYPSGNLHIGHAYSTVAGDVIARYKRMQGYDVRYLTGTDEHGQKIQEKAQKAGKTEIEYLDEMIAGIKQLWAKLEISNDDFIRTTEERHKHVVEQVFERLLKQGDIYLGEYEGWYSVPDETYYTESQLVDPQYENGKIIGGKSPDSGHEVELVKEESYFFNISKYTDRLLEFYDQNPDFIQPPSRKNEMINNFIKPGLADLAVSRTSFNWGVHVPSNPKHVVYVWIDALVNYISALGYLSDDESLFNKYWPADIHLMAKEIVRFHSIIWPILLMALDLPLPKKVFAHGWILMKDGKMSKSKGNVVDPNILIDRYGLDATRYYLMRELPFGSDGVFTPEAFVERTNFDLANDLGNLVNRTISMVNKYFDGELPAYQGPLHELDEEMEAMALETVKSYTESMESLQFSVALSTVWKFISRTNKYIDETTPWVLAKDDSQKDMLGNVMAHLVENIRYAAVLLRPFLTHAPKEIFEQLNINNPQFMEFSSLEQYGVLTESIMVTGQPKPIFPRLDSEAEIAYIKESMQPPATEEEKEEIPSKPQIDIKDFDKVEIKAATIIDAEHVKKSDKLLKIQVDLDSEQRQIVSGIAKFYTPDDIIGKKVAVVTNLKPAKLMGQKSEGMILSAEKDGVLTLVSLPSAIPNGAVIK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 2.000 2.001 2.002 2.003 2.004 2.005 2.006 2.007 2.008 2.009 2.010 2.011 2.012 2.013 2.014 2.015 2.016 2.017 2.018 2.019 2.020 2.021 2.022 2.023 2.024 2.025 2.026 2.027 2.028 2.029 2.030 2.031 2.032 2.033 2.034 2.035 2.036 2.037 2.038 2.039 2.040 2.041 2.042 2.043 2.044 2.045 2.046 2.047 2.048 2.049 2.050 2.051 2.052 2.053 2.054 2.055 2.056 2.057 2.058 2.059 2.060 2.061 2.062 2.063 2.064 2.065 2.066 2.067 2.068 2.069 2.070 2.071 2.072 2.073 2.074 2.075 2.076 2.077 2.078 2.079 2.080 2.081 2.082 2.083 2.084 2.085 2.086 2.087 2.088 2.089 2.090 2.091 2.092 2.093 2.094 2.095 2.096 2.097 2.098 2.099 2.100 2.101 2.102 2.103 2.104 2.105 2.106 2.107 2.108

Relevant publications[edit source | edit]