From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0603 [new locus tag: SA_RS03465 ]
  • pan locus tag?: SAUPAN002526000
  • symbol: fhuB
  • pan gene symbol?: fhuB
  • synonym:
  • product: ferrichrome ABC transporter permease

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA0603 [new locus tag: SA_RS03465 ]
  • symbol: fhuB
  • product: ferrichrome ABC transporter permease
  • replicon: chromosome
  • strand: +
  • coordinates: 698190..699194
  • length: 1005
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    ATGACAAATAGAGAGAACCCAACGCCATTGAAGTTTTTATCCTATATTATAGGTTTAAGT
    ATGATACTACTAATCACACTATTTATTTCTACATTAATAGGTGACGCCAAAATTCAAGCC
    TCTACAATTATAGAGGCTATTTTTAATTATAATCCTAGCAATCAACAGCAAAACATCATC
    AATGAGATTAGGATTCCCAGAAATATAGCAGCAGTAATTGTAGGTATGGCGCTTGCAGTT
    TCTGGTGCGATTATACAAGGTGTTACTCGTAATGGTCTTGCTGATCCGGCGCTCATAGGT
    TTAAATTCAGGTGCTTCATTTGCTTTAGCATTAACATATGCAGTTTTACCAAACACTTCA
    TTTTTAATATTGATGTTTGCTGGATTTTTAGGTGCTATTCTAGGAGGTGCTATTGTATTA
    ATGATAGGCCGATCTAGACGTGATGGATTTAATCCGATGCGTATTATTTTAGCGGGTGCA
    GCAGTAAGTGCTATGTTAACAGCGCTAAGTCAAGGTATTGCATTAGCTTTTAGACTAAAT
    CAAACAGTAACATTTTGGACTGCTGGAGGCGTTTCAGGCACAACATGGTCACACCTTAAG
    TGGGCAATTCCATTAATTGGTATTGCGTTATTCATTATATTAACAATTAGTAAACAACTT
    ACCATTTTAAATCTTGGTGAATCATTAGCTAAAGGTTTAGGTCAAAATGTAACAATGATC
    AGAGGCATATGTTTAATTATTGCTATGATTCTAGCAGGTATTGCAGTTGCTATCGCTGGA
    CAAGTTGCATTTGTAGGTTTGATGGTACCTCATATAGCAAGATTTTTAATTGGAACTGAT
    TATGCTAAAATTCTACCATTAACAGCCTTGTTAGGTGGGATACTCGTGCTTGTTGCCGAT
    GTGATAGCACGATATTTAGGAGAAGCGCCTGTTGGTGCAATCATTTCATTTATCGGTGTT
    CCTTACTTTTTATATTTAGTTAAAAAAGGAGGACGCTCAATATGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1005

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA0603 [new locus tag: SA_RS03465 ]
  • symbol: FhuB
  • description: ferrichrome ABC transporter permease
  • length: 334
  • theoretical pI: 10.6575
  • theoretical MW: 35183
  • GRAVY: 0.973952

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    proposed F420-0 ABC transporter, permease protein (TIGR03869; HMM-score: 156.1)
  • TheSEED:  
    ABC-type Fe3+-siderophore transport system, permease component 
  • PFAM:
    Membrane_trans (CL0142) FecCD; FecCD transport family (PF01032; HMM-score: 295)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA0033(aadD)kanamycin nucleotidyltransferase  [1] (data from MRSA252)
    SA1533(ackA)acetate kinase  [1] (data from MRSA252)
    SA0562(adh1)alcohol dehydrogenase  [1] (data from MRSA252)
    SA1984(asp23)alkaline shock protein 23  [1] (data from MRSA252)
    SA1184(citB)aconitate hydratase  [1] (data from MRSA252)
    SA1517(citC)isocitrate dehydrogenase  [1] (data from MRSA252)
    SA1887(ddl)D-alanyl-alanine synthetase A  [1] (data from MRSA252)
    SA1409(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    SA0869(fabI)enoyl-ACP reductase  [1] (data from MRSA252)
    SA0915(folD)bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase  [1] (data from MRSA252)
    SA0505(fus)elongation factor G  [1] (data from MRSA252)
    SA1510(gapB)glyceraldehyde 3-phosphate dehydrogenase 2  [1] (data from MRSA252)
    SA1716(gatA)aspartyl/glutamyl-tRNA amidotransferase subunit A  [1] (data from MRSA252)
    SA1715(gatB)aspartyl/glutamyl-tRNA amidotransferase subunit B  [1] (data from MRSA252)
    SA1959(glmS)glucosamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    SA1150(glnA)glutamine-ammonia ligase  [1] (data from MRSA252)
    SA1836(groEL)molecular chaperone GroEL  [1] (data from MRSA252)
    SA0376(guaA)GMP synthase  [1] (data from MRSA252)
    SA0232(lctE)L-lactate dehydrogenase  [1] (data from MRSA252)
    SA2400(mqo2)malate:quinone oxidoreductase  [1] (data from MRSA252)
    SA1926(murZ)UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [1] (data from MRSA252)
    SA1244(odhB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    SA0946(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    SA1938(pdp)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    SA0218(pflB)formate acetyltransferase  [1] (data from MRSA252)
    SA0730(pgm)phosphoglyceromutase  [1] (data from MRSA252)
    SA1106(proS)prolyl-tRNA synthetase  [1] (data from MRSA252)
    SA1520(pykA)pyruvate kinase  [1] (data from MRSA252)
    SA0496(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    SA2044(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    SA2047(rplC)50S ribosomal protein L3  [1] (data from MRSA252)
    SA2046(rplD)50S ribosomal protein L4  [1] (data from MRSA252)
    SA2035(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    SA0497(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    SA0495(rplK)50S ribosomal protein L11  [1] (data from MRSA252)
    SA0498(rplL)50S ribosomal protein L7/L12  [1] (data from MRSA252)
    SA2017(rplM)50S ribosomal protein L13  [1] (data from MRSA252)
    SA2029(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    SA2032(rplR)50S ribosomal protein L18  [1] (data from MRSA252)
    SA1084(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    SA1473(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    SA2042(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    SA2045(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    SA2036(rplX)50S ribosomal protein L24  [1] (data from MRSA252)
    SA0459(rplY)50S ribosomal protein L25  [1] (data from MRSA252)
    SA1471(rpmA)50S ribosomal protein L27  [1] (data from MRSA252)
    SA1503(rpmI)50S ribosomal protein L35  [1] (data from MRSA252)
    SA2023(rpoA)DNA-directed RNA polymerase subunit alpha  [1] (data from MRSA252)
    SA0500(rpoB)DNA-directed RNA polymerase subunit beta  [1] (data from MRSA252)
    SA1308(rpsA)30S ribosomal protein S1  [1] (data from MRSA252)
    SA1099(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    SA2041(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    SAS052(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    SA0352(rpsF)30S ribosomal protein S6  [1] (data from MRSA252)
    SA2034(rpsH)30S ribosomal protein S8  [1] (data from MRSA252)
    SA2016(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    SA2024(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    SA0503(rpsL)30S ribosomal protein S12  [1] (data from MRSA252)
    SA2025(rpsM)30S ribosomal protein S13  [1] (data from MRSA252)
    SA2038(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    SA0354(rpsR)30S ribosomal protein S18  [1] (data from MRSA252)
    SA2043(rpsS)30S ribosomal protein S19  [1] (data from MRSA252)
    SA0009(serS)seryl-tRNA synthetase  [1] (data from MRSA252)
    SA0456(spoVG)regulatory protein SpoVG  [1] (data from MRSA252)
    SA1088(sucC)succinyl-CoA synthetase subunit beta  [1] (data from MRSA252)
    SA1499(tig)trigger factor  [1] (data from MRSA252)
    SA0729(tpiA)triosephosphate isomerase  [1] (data from MRSA252)
    SA0466hypothetical protein  [1] (data from MRSA252)
    SA0477pyridoxal biosynthesis lyase PdxS  [1] (data from MRSA252)
    SA0587hypothetical protein  [1] (data from MRSA252)
    SA0829hypothetical protein  [1] (data from MRSA252)
    SA0873hypothetical protein  [1] (data from MRSA252)
    SA1532hypothetical protein  [1] (data from MRSA252)
    SA1559hypothetical protein  [1] (data from MRSA252)
    SA1709hypothetical protein  [1] (data from MRSA252)
    SA1924hypothetical protein  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 9
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: 0.5
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.287
    • Ymax_pos: 39
    • Cmax: 0.257
    • Cmax_pos: 39
    • Smax: 0.53
    • Smax_pos: 36
    • Smean: 0.236
    • D: 0.267
  • predicted transmembrane helices (TMHMM): 9

Accession numbers[edit source | edit]

  • GI: 15926325 NCBI
  • RefSeq: NP_373858 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MTNRENPTPLKFLSYIIGLSMILLITLFISTLIGDAKIQASTIIEAIFNYNPSNQQQNIINEIRIPRNIAAVIVGMALAVSGAIIQGVTRNGLADPALIGLNSGASFALALTYAVLPNTSFLILMFAGFLGAILGGAIVLMIGRSRRDGFNPMRIILAGAAVSAMLTALSQGIALAFRLNQTVTFWTAGGVSGTTWSHLKWAIPLIGIALFIILTISKQLTILNLGESLAKGLGQNVTMIRGICLIIAMILAGIAVAIAGQVAFVGLMVPHIARFLIGTDYAKILPLTALLGGILVLVADVIARYLGEAPVGAIISFIGVPYFLYLVKKGGRSI

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: SA1329 (Fur*)
    Fur* (TF) important in Iron homeostasisRegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 1.49 1.50 1.51 1.52 1.53 1.54 1.55 1.56 1.57 1.58 1.59 1.60 1.61 1.62 1.63 1.64 1.65 1.66 1.67 1.68 1.69 1.70 1.71 1.72 1.73 1.74 1.75 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]