From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS02190 [old locus tag: SACOL0435 ]
  • pan locus tag?: SAUPAN001909000
  • symbol: SACOL_RS02190
  • pan gene symbol?: ychF
  • synonym:
  • product: GTP-binding protein YchF

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS02190 [old locus tag: SACOL0435 ]
  • symbol: SACOL_RS02190
  • product: GTP-binding protein YchF
  • replicon: chromosome
  • strand: +
  • coordinates: 441076..442173
  • length: 1098
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (441076..442173) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    ATGGCTTTAACAGCAGGTATCGTTGGATTGCCAAACGTTGGTAAATCAACATTATTTAAT
    GCAATAACAAAAGCAGGTGCTTTAGCAGCGAACTATCCATTCGCTACGATTGATCCTAAT
    GTAGGGATAGTAGAAGTGCCAGATGCTAGATTACTTAAATTAGAAGAAATGGTTCAACCT
    AAAAAGACATTGCCGACTACATTTGAATTTACAGATATCGCTGGTATTGTGAAAGGTGCT
    TCAAAGGGAGAAGGGTTAGGTAATAAATTCTTATCACATATTAGAGAAGTAGATGCGATT
    TGTCAGGTCGTTCGTGCATTTGATGATGATAACGTAACTCATGTTGCTGGTCGAGTAGAC
    CCTATTGATGATATTGAAGTTATTAATATGGAATTAGTACTAGCGGACTTAGAATCTGTT
    GAGAAACGTTTGCCTAGAATTGAAAAATTAGCACGTCAAAAAGATAAGACTGCTGAAATG
    GAAGTACGTATTTTAACAACTATTAAAGAAGCTTTAGAAAATGGTAAACCCGCTCGTAGT
    ATTGACTTTAATGAAGAAGATCAAAAATGGGTGAATCAAGCGCAATTACTGACTTCTAAA
    AAAATGCTTTATATCGCTAATGTTGGTGAAGATGAAATTGGTGATGATGATAATGATAAA
    GTAAAAGCGATTCGTGAATATGCAGCGCAAGAAGACTCTGAAGTGATTGTTATTAGTGCA
    AAAATTGAAGAAGAAATTGCTACATTAGATGATGAAGATAAAGAAATGTTCTTAGAAGAT
    TTAGGTATCGAAGAACCAGGATTAGATCGATTAATTAGAACAACTTATGAATTATTAGGA
    TTATCAACATATTTTACTGCTGGTGTGCAAGAAGTACGTGCTTGGACATTTAAACAAGGT
    ATGACTGCACCTCAATGTGCTGGTATCATTCATACTGATTTTGAACGTGGATTTATCCGT
    GCCGAAGTAACAAGTTATGACGACTATGTACAATATGGTGGCGAAAGTGGCGCTAAAGAA
    GCGGGCAGACAACGATTAGAAGGTAAAGAATATATTATGCAAGATGGCGATATCGTTCAT
    TTCAGATTTAATGTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1098

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS02190 [old locus tag: SACOL0435 ]
  • symbol: SACOL_RS02190
  • description: GTP-binding protein YchF
  • length: 365
  • theoretical pI: 4.33991
  • theoretical MW: 40594.7
  • GRAVY: -0.288767

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Unknown functionGeneralGTP-binding protein YchF (TIGR00092; HMM-score: 516.4)
    Genetic information processingProtein synthesisOtherObg family GTPase CgtA (TIGR02729; HMM-score: 80.9)
    Unknown functionGeneralGTP-binding protein HflX (TIGR03156; HMM-score: 37.8)
    Unknown functionGeneralsmall GTP-binding protein domain (TIGR00231; HMM-score: 33.3)
    Genetic information processingProtein synthesisOtherribosome-associated GTPase EngA (TIGR03594; HMM-score: 30.9)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsferrous iron transport protein B (TIGR00437; HMM-score: 27.9)
    Genetic information processingProtein synthesisOtherribosome biogenesis GTP-binding protein YlqF (TIGR03596; HMM-score: 24.4)
    Genetic information processingProtein synthesisOtherGTP-binding protein Era (TIGR00436; HMM-score: 20.9)
    Genetic information processingProtein fateProtein modification and repair[FeFe] hydrogenase H-cluster maturation GTPase HydF (TIGR03918; HMM-score: 19.2)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA modification GTPase TrmE (TIGR00450; EC 3.6.-.-; HMM-score: 14.1)
    Genetic information processingProtein synthesisOtherribosome biogenesis GTP-binding protein YsxC (TIGR03598; HMM-score: 14.1)
    Genetic information processingProtein synthesisOtherribosome biogenesis GTPase YqeH (TIGR03597; HMM-score: 13.5)
  • TheSEED:
  • PFAM:
    Ubiquitin (CL0072) YchF-GTPase_C; Protein of unknown function (DUF933) (PF06071; HMM-score: 136.6)
    P-loop_NTPase (CL0023) MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 83.5)
    FeoB_N; Ferrous iron transport protein B (PF02421; HMM-score: 33.1)
    Ubiquitin (CL0072) TGS; TGS domain (PF02824; HMM-score: 15.5)

Structure, modifications & interactions[edit source | edit]

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.291
    • Ymax_pos: 30
    • Cmax: 0.21
    • Cmax_pos: 30
    • Smax: 0.596
    • Smax_pos: 25
    • Smean: 0.366
    • D: 0.321
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 447141476 NCBI
  • RefSeq: WP_001218732 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MALTAGIVGLPNVGKSTLFNAITKAGALAANYPFATIDPNVGIVEVPDARLLKLEEMVQPKKTLPTTFEFTDIAGIVKGASKGEGLGNKFLSHIREVDAICQVVRAFDDDNVTHVAGRVDPIDDIEVINMELVLADLESVEKRLPRIEKLARQKDKTAEMEVRILTTIKEALENGKPARSIDFNEEDQKWVNQAQLLTSKKMLYIANVGEDEIGDDDNDKVKAIREYAAQEDSEVIVISAKIEEEIATLDDEDKEMFLEDLGIEEPGLDRLIRTTYELLGLSTYFTAGVQEVRAWTFKQGMTAPQCAGIIHTDFERGFIRAEVTSYDDYVQYGGESGAKEAGRQRLEGKEYIMQDGDIVHFRFNV

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS02190 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 1.49 1.50 1.51 1.52 1.53 1.54 1.55 1.56 1.57 1.58 1.59 1.60 1.61 1.62 1.63 1.64 1.65 1.66 1.67 1.68 1.69 1.70 1.71 1.72 1.73 1.74 1.75 1.76 1.77 1.78 1.79 1.80 1.81 1.82 1.83 1.84 1.85 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]