From AureoWiki
Jump to: navigation, search

NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS07920 [old locus tag: SA1402 ]
  • pan locus tag?: SAUPAN004156000
  • symbol: SA_RS07920
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA_RS07920 [old locus tag: SA1402 ]
  • symbol: SA_RS07920
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1606787..1607776
  • length: 990
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002745 (1606787..1607776) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    ATGTTTAGTTTAAGTTTTATCGTAATAGCAGTTATTATAATAGTTGCATTACTTATTTTA
    TTCTCATTTGTACCGATTGGTTTGTGGATTTCAGCGTTAGCAGCTGGCGTTCATGTTGGT
    ATAGGTACATTGGTTGGTATGCGTTTACGTCGTGTATCTCCAAGAAAAGTTATAGCGCCA
    TTAATTAAAGCGCACAAAGCAGGACTAGCATTAACAACAAACCAATTAGAATCGCATTAT
    CTAGCAGGAGGAAATGTTGACAGAGTTGTTGATGCTAATATTGCTGCACAACGTGCTGAC
    ATTGATCTTCCTTTCGAACGTGCTGCTGCAATTGACCTTGCAGGACGTGACGTATTAGAA
    GCGGTTCAAATGTCTGTTAATCCTAAAGTCATTGAAACACCATTTATCGCAGGTGTAGCA
    ATGAACGGTATTGAAGTGAAAGCCAAAGCTCGTATCACAGTTAGAGCTAATATTGCTCGA
    CTTGTTGGTGGTGCAGGTGAAGAAACAATCATCGCACGTGTTGGTGAAGGTATCGTTTCA
    ACAATTGGTTCTAGTAAGCATCATACAGAAGTACTTGAAAACCCAGATAATATTTCTAAA
    ACAGTTTTAAGCAAAGGTTTAGATTCAGGTACTGCATTTGAAATTTTATCAATTGATATT
    GCTGACGTTGATATTAGTAAAAATATTGGTGCAGACTTACAAACTGAACAAGCATTAGCA
    GACAAAAATATTGCACAAGCAAAAGCTGAAGAACGTAGAGCTATGGCTGTAGCAACTGAG
    CAAGAAATGAAAGCGCGTGTACAAGAAATGCATGCTAAAGTAGTTGAAGCCGAATCTGAA
    GTACCATTAGCTATGGCTGAAGCATTACGTTCAGGTAATATCAGTGTTAAAGATTATTAT
    AATTTGAAAAATATCGAAGCTGATACAGGCATGAGAAATGCAATTAATAAACGAACTGAT
    CAAAGTGATGATGAGTCACCTGAACATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    990

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA_RS07920 [old locus tag: SA1402 ]
  • symbol: SA_RS07920
  • description: hypothetical protein
  • length: 329
  • theoretical pI: 5.67882
  • theoretical MW: 35195.3
  • GRAVY: 0.129179

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismTransport and binding proteinsCations and iron carrying compoundscobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 14.9)
  • TheSEED:
  • PFAM:
    no clan definedYdfA_immunity; SigmaW regulon antibacterial (PF12127; HMM-score: 534.5)
    tRNA_bind_arm (CL0298) Seryl_tRNA_N; Seryl-tRNA synthetase N-terminal domain (PF02403; HMM-score: 19.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA_RS11130(deoA)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    SA_RS06280(nusA)transcription termination/antitermination protein NusA  [1] (data from MRSA252)
    SA_RS00690immunoglobulin G-binding protein A  [1] (data from MRSA252)
    SA_RS00980aldehyde dehydrogenase  [1] (data from MRSA252)
    SA_RS01275formate acetyltransferase  [1] (data from MRSA252)
    SA_RS01365L-lactate dehydrogenase  [1] (data from MRSA252)
    SA_RS014452-C-methyl-D-erythritol 4-phosphate cytidylyltransferase  [1] (data from MRSA252)
    SA_RS02095alkyl hydroperoxide reductase subunit C  [1] (data from MRSA252)
    SA_RS02145IMP dehydrogenase  [1] (data from MRSA252)
    SA_RS02405methionine ABC transporter substrate-binding protein  [1] (data from MRSA252)
    SA_RS0265050S ribosomal protein L25/general stress protein Ctc  [1] (data from MRSA252)
    SA_RS02695hypoxanthine-guanine phosphoribosyltransferase  [1] (data from MRSA252)
    SA_RS02710cysteine synthase  [1] (data from MRSA252)
    SA_RS02810pyridoxal 5'-phosphate synthase lyase subunit PdxS  [1] (data from MRSA252)
    SA_RS0290550S ribosomal protein L11  [1] (data from MRSA252)
    SA_RS02930DNA-directed RNA polymerase subunit beta  [1] (data from MRSA252)
    SA_RS0295030S ribosomal protein S7  [1] (data from MRSA252)
    SA_RS02955elongation factor G  [1] (data from MRSA252)
    SA_RS02960elongation factor Tu  [1] (data from MRSA252)
    SA_RS03155phosphate acetyltransferase  [1] (data from MRSA252)
    SA_RS03250zinc-dependent alcohol dehydrogenase  [1] (data from MRSA252)
    SA_RS03380metal ABC transporter substrate-binding protein  [1] (data from MRSA252)
    SA_RS03475dihydroxyacetone kinase subunit DhaK  [1] (data from MRSA252)
    SA_RS03665MarR family transcriptional regulator  [1] (data from MRSA252)
    SA_RS03910ribonucleotide-diphosphate reductase subunit alpha  [1] (data from MRSA252)
    SA_RS04140aldehyde dehydrogenase  [1] (data from MRSA252)
    SA_RS04145phosphoglycerate kinase  [1] (data from MRSA252)
    SA_RS04150triose-phosphate isomerase  [1] (data from MRSA252)
    SA_RS041552,3-bisphosphoglycerate-independent phosphoglycerate mutase  [1] (data from MRSA252)
    SA_RS04160enolase  [1] (data from MRSA252)
    SA_RS04325arsenate reductase  [1] (data from MRSA252)
    SA_RS04330glycine cleavage system protein H  [1] (data from MRSA252)
    SA_RS04575NADH dehydrogenase  [1] (data from MRSA252)
    SA_RS04660NAD-specific glutamate dehydrogenase  [1] (data from MRSA252)
    SA_RS04680glucose-6-phosphate isomerase  [1] (data from MRSA252)
    SA_RS04785beta-ketoacyl-[acyl-carrier-protein] synthase II  [1] (data from MRSA252)
    SA_RS04935hypothetical protein  [1] (data from MRSA252)
    SA_RS05005lipoate--protein ligase A  [1] (data from MRSA252)
    SA_RS05295phosphocarrier protein HPr  [1] (data from MRSA252)
    SA_RS05300phosphoenolpyruvate--protein phosphotransferase  [1] (data from MRSA252)
    SA_RS05325ribonuclease J 1  [1] (data from MRSA252)
    SA_RS05350pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SA_RS05360dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex  [1] (data from MRSA252)
    SA_RS05620thiol reductase thioredoxin  [1] (data from MRSA252)
    SA_RS05895isoleucine--tRNA ligase  [1] (data from MRSA252)
    SA_RS05945carbamoyl-phosphate synthase large chain  [1] (data from MRSA252)
    SA_RS06085beta-ketoacyl-ACP reductase  [1] (data from MRSA252)
    SA_RS06165succinyl-CoA ligase subunit beta  [1] (data from MRSA252)
    SA_RS06215GTP-sensing pleiotropic transcriptional regulator CodY  [1] (data from MRSA252)
    SA_RS0622530S ribosomal protein S2  [1] (data from MRSA252)
    SA_RS06235elongation factor Ts  [1] (data from MRSA252)
    SA_RS06490glutamine synthetase  [1] (data from MRSA252)
    SA_RS06690transketolase  [1] (data from MRSA252)
    SA_RS06730aconitate hydratase  [1] (data from MRSA252)
    SA_RS07210alanine dehydrogenase  [1] (data from MRSA252)
    SA_RS07605phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)  [1] (data from MRSA252)
    SA_RS07700peptidase M24 family protein  [1] (data from MRSA252)
    SA_RS07880glycine--tRNA ligase  [1] (data from MRSA252)
    SA_RS08135hypothetical protein  [1] (data from MRSA252)
    SA_RS08435trigger factor  [1] (data from MRSA252)
    SA_RS08480threonine--tRNA ligase  [1] (data from MRSA252)
    SA_RS08505aldehyde dehydrogenase  [1] (data from MRSA252)
    SA_RS08550citrate synthase  [1] (data from MRSA252)
    SA_RS08560pyruvate kinase  [1] (data from MRSA252)
    SA_RS08625universal stress protein UspA  [1] (data from MRSA252)
    SA_RS08630acetate kinase  [1] (data from MRSA252)
    SA_RS086402-Cys peroxiredoxin  [1] (data from MRSA252)
    SA_RS08760formate--tetrahydrofolate ligase  [1] (data from MRSA252)
    SA_RS08860D-alanine aminotransferase  [1] (data from MRSA252)
    SA_RS08865dipeptidase PepV  [1] (data from MRSA252)
    SA_RS09005transaldolase  [1] (data from MRSA252)
    SA_RS09710glutamine amidotransferase  [1] (data from MRSA252)
    SA_RS09850aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B  [1] (data from MRSA252)
    SA_RS09960manganese-dependent inorganic pyrophosphatase  [1] (data from MRSA252)
    SA_RS10535molecular chaperone GroEL  [1] (data from MRSA252)
    SA_RS11010uracil phosphoribosyltransferase  [1] (data from MRSA252)
    SA_RS11075fructose-bisphosphate aldolase  [1] (data from MRSA252)
    SA_RS11085CTP synthetase  [1] (data from MRSA252)
    SA_RS11145purine-nucleoside phosphorylase  [1] (data from MRSA252)
    SA_RS11245glutamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    SA_RS11430Asp23/Gls24 family envelope stress response protein  [1] (data from MRSA252)
    SA_RS1163050S ribosomal protein L17  [1] (data from MRSA252)
    SA_RS1173530S ribosomal protein S3  [1] (data from MRSA252)
    SA_RS12400quinone oxidoreductase  [1] (data from MRSA252)
    SA_RS126452,3-bisphosphoglycerate-dependent phosphoglycerate mutase  [1] (data from MRSA252)
    SA_RS13375hydroxymethylglutaryl-CoA synthase  [1] (data from MRSA252)
    SA_RS13705L-lactate dehydrogenase  [1] (data from MRSA252)
    SA_RS13730class I fructose-bisphosphate aldolase  [1] (data from MRSA252)
    SA_RS13735malate:quinone oxidoreductase  [1] (data from MRSA252)
    SA_RS13915ornithine carbamoyltransferase  [1] (data from MRSA252)
    SA_RS13920arginine deiminase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 2
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.183
    • Ymax_pos: 35
    • Cmax: 0.263
    • Cmax_pos: 35
    • Smax: 0.276
    • Smax_pos: 2
    • Smean: 0.155
    • D: 0.172
  • predicted transmembrane helices (TMHMM): 2

Accession numbers[edit source | edit]

  • GI: 446414253 NCBI
  • RefSeq: WP_000492108 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MFSLSFIVIAVIIIVALLILFSFVPIGLWISALAAGVHVGIGTLVGMRLRRVSPRKVIAPLIKAHKAGLALTTNQLESHYLAGGNVDRVVDANIAAQRADIDLPFERAAAIDLAGRDVLEAVQMSVNPKVIETPFIAGVAMNGIEVKAKARITVRANIARLVGGAGEETIIARVGEGIVSTIGSSKHHTEVLENPDNISKTVLSKGLDSGTAFEILSIDIADVDISKNIGADLQTEQALADKNIAQAKAEERRAMAVATEQEMKARVQEMHAKVVEAESEVPLAMAEALRSGNISVKDYYNLKNIEADTGMRNAINKRTDQSDDESPEH

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA_RS07920 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 1.49 1.50 1.51 1.52 1.53 1.54 1.55 1.56 1.57 1.58 1.59 1.60 1.61 1.62 1.63 1.64 1.65 1.66 1.67 1.68 1.69 1.70 1.71 1.72 1.73 1.74 1.75 1.76 1.77 1.78 1.79 1.80 1.81 1.82 1.83 1.84 1.85 1.86 1.87 1.88 1.89 1.90 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]