From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_1476 [new locus tag: NWMN_RS08315 ]
  • pan locus tag?: SAUPAN004156000
  • symbol: NWMN_1476
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_1476 [new locus tag: NWMN_RS08315 ]
  • symbol: NWMN_1476
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1642685..1643674
  • length: 990
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    ATGTTTAGTTTAAGTTTTATCGTAATAGCAGTTATTATAGTAGTTGCATTACTTATTTTA
    TTCTCATTTGTACCCATTGGTTTATGGATTTCAGCGTTAGCAGCTGGCGTTCATGTTGGT
    ATAGGTACATTGGTTGGTATGCGTTTACGTCGTGTATCTCCAAGAAAAGTTATAGCGCCA
    TTAATTAAAGCGCACAAAGCAGGACTAGCATTAACAACAAACCAATTAGAATCGCATTAT
    CTAGCAGGAGGAAATGTTGACAGAGTTGTTGACGCTAATATTGCTGCACAACGTGCTGAC
    ATTGATCTTCCTTTCGAACGTGCTGCTGCAATTGACCTTGCAGGACGTGACGTATTAGAA
    GCGGTTCAAATGTCTGTTAATCCTAAAGTCATTGAAACACCATTTATCGCAGGTGTAGCA
    ATGAACGGTATTGAAGTGAAAGCCAAAGCTCGTATCACAGTTAGAGCTAATATTGCTCGA
    CTTGTTGGTGGTGCTGGTGAAGAAACAATCATCGCACGTGTTGGTGAAGGTATCGTTTCA
    ACAATTGGTTCTAGTAAGCATCATACAGAAGTACTTGAAAACCCAGATAATATTTCTAAA
    ACAGTTTTAAGCAAAGGTTTAGATTCAGGTACTGCATTTGAAATTTTATCAATTGATATT
    GCTGACGTTGATATTAGTAAAAATATTGGTGCAGACTTACAAACTGAACAAGCATTAGCA
    GACAAAAATATTGCACAAGCAAAAGCTGAAGAACGTAGAGCTATGGCTGTAGCAACTGAG
    CAAGAAATGAAAGCGCGTGTACAAGAAATGCATGCTAAAGTAGTTGAAGCCGAATCTGAA
    GTACCATTAGCTATGGCTGAAGCATTACGTTCAGGTAATATCAGTGTTAAAGATTATTAT
    AATTTGAAAAATATCGAAGCTGATACAGGCATGAGAAATGCAATTAATAAACGAACTGAT
    CAAAGTGATGATGAGTCACCTGAACATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    990

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_1476 [new locus tag: NWMN_RS08315 ]
  • symbol: NWMN_1476
  • description: hypothetical protein
  • length: 329
  • theoretical pI: 5.67882
  • theoretical MW: 35181.2
  • GRAVY: 0.128267

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismTransport and binding proteinsCations and iron carrying compoundscobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 14.9)
  • TheSEED:  
    UPF0365 protein YqfA 
  • PFAM:
    no clan definedYdfA_immunity; SigmaW regulon antibacterial (PF12127; HMM-score: 534.6)
    tRNA_bind_arm (CL0298) Seryl_tRNA_N; Seryl-tRNA synthetase N-terminal domain (PF02403; HMM-score: 19.8)
    no clan definedSensor; Putative sensor (PF13796; HMM-score: 11.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    NWMN_1605(ackA)acetate kinase  [1] (data from MRSA252)
    NWMN_0577(adh1)alcohol dehydrogenase  [1] (data from MRSA252)
    NWMN_0372(ahpC)alkyl hydroperoxide reductase subunit C  [1] (data from MRSA252)
    NWMN_1349(ald)alanine dehydrogenase  [1] (data from MRSA252)
    NWMN_0113(aldA)aldehyde dehydrogenase-like protein  [1] (data from MRSA252)
    NWMN_2534(arcA)arginine deiminase  [1] (data from MRSA252)
    NWMN_2533(arcB)ornithine carbamoyltransferase  [1] (data from MRSA252)
    NWMN_1114(carB)carbamoyl phosphate synthase large subunit  [1] (data from MRSA252)
    NWMN_1588(citZ)citrate synthase  [1] (data from MRSA252)
    NWMN_1165(codY)transcriptional repressor CodY  [1] (data from MRSA252)
    NWMN_2042(deoD)purine nucleoside phosphorylase  [1] (data from MRSA252)
    NWMN_0745(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    NWMN_0551(eutD)phosphotransacetylase  [1] (data from MRSA252)
    NWMN_1141(fabG)3-oxoacyl-[acyl-carrier protein] reductase  [1] (data from MRSA252)
    NWMN_2029(fbaA)fructose-bisphosphate aldolase  [1] (data from MRSA252)
    NWMN_1625(fhs)formate--tetrahydrofolate ligase  [1] (data from MRSA252)
    NWMN_0509(fus)elongation factor G  [1] (data from MRSA252)
    NWMN_0741(gapA)glyceraldehyde 3-phosphate dehydrogenase 1  [1] (data from MRSA252)
    NWMN_1580(gapB)glyceraldehyde 3-phosphate dehydrogenase 2  [1] (data from MRSA252)
    NWMN_1837(gatB)aspartyl/glutamyl-tRNA amidotransferase subunit B  [1] (data from MRSA252)
    NWMN_2056(glmS)glucosamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    NWMN_1217(glnA)glutamine synthetase  [1] (data from MRSA252)
    NWMN_1468(glyS)glycyl-tRNA synthetase  [1] (data from MRSA252)
    NWMN_1417(gnd)6-phosphogluconate dehydrogenase  [1] (data from MRSA252)
    NWMN_2315(gpmA)phosphoglyceromutase  [1] (data from MRSA252)
    NWMN_1937(groEL)chaperonin GroEL  [1] (data from MRSA252)
    NWMN_0380(guaB)inosine-5'-monophosphate dehydrogenase  [1] (data from MRSA252)
    NWMN_0828(gudB)NAD-specific glutamate dehydrogenase  [1] (data from MRSA252)
    NWMN_0472(hpt)hypoxanthine phosphoribosyltransferase  [1] (data from MRSA252)
    NWMN_1103(ileS)isoleucyl-tRNA synthetase  [1] (data from MRSA252)
    NWMN_0189(ispD)2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase  [1] (data from MRSA252)
    NWMN_2499(ldh)L-lactate dehydrogenase 2  [1] (data from MRSA252)
    NWMN_0176(ldh1)L-lactate dehydrogenase  [1] (data from MRSA252)
    NWMN_2446(mvaS)3-hydroxy-3-methylglutaryl coenzyme A synthase  [1] (data from MRSA252)
    NWMN_0700(nrdE)ribonucleotide-diphosphate reductase subunit alpha  [1] (data from MRSA252)
    NWMN_1176(nusA)transcription elongation factor NusA  [1] (data from MRSA252)
    NWMN_0961(pdhC)branched-chain alpha-keto acid dehydrogenase subunit E2  [1] (data from MRSA252)
    NWMN_2040(pdp)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    NWMN_0162(pflB)formate acetyltransferase  [1] (data from MRSA252)
    NWMN_0833(pgi)glucose-6-phosphate isomerase  [1] (data from MRSA252)
    NWMN_0742(pgk)phosphoglycerate kinase  [1] (data from MRSA252)
    NWMN_0744(pgm)phosphoglyceromutase  [1] (data from MRSA252)
    NWMN_0959(phdA)pyruvate dehydrogenase E1 component, alpha subunit  [1] (data from MRSA252)
    NWMN_1592(pykA)pyruvate kinase  [1] (data from MRSA252)
    NWMN_2031(pyrG)CTP synthetase  [1] (data from MRSA252)
    NWMN_0499(rplK)50S ribosomal protein L11  [1] (data from MRSA252)
    NWMN_2125(rplQ)50S ribosomal protein L17  [1] (data from MRSA252)
    NWMN_0464(rplY)50S ribosomal protein L25/general stress protein Ctc  [1] (data from MRSA252)
    NWMN_0504(rpoB)DNA-directed RNA polymerase subunit beta  [1] (data from MRSA252)
    NWMN_1166(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    NWMN_2146(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    NWMN_0508(rpsG)30S ribosomal protein S7  [1] (data from MRSA252)
    NWMN_0055(spa)immunoglobulin G binding protein A precursor (protein A)  [1] (data from MRSA252)
    NWMN_1155(sucC)succinyl-CoA synthetase subunit beta  [1] (data from MRSA252)
    NWMN_1576(thrS)threonyl-tRNA synthetase  [1] (data from MRSA252)
    NWMN_1569(tig)trigger factor  [1] (data from MRSA252)
    NWMN_1254(tkt)transketolase  [1] (data from MRSA252)
    NWMN_0743(tpiA)triosephosphate isomerase  [1] (data from MRSA252)
    NWMN_1607(tpx)thiol peroxidase  [1] (data from MRSA252)
    NWMN_1057(trxA)thioredoxin  [1] (data from MRSA252)
    NWMN_1167(tsf)elongation factor Ts  [1] (data from MRSA252)
    NWMN_0510(tufA)elongation factor Tu  [1] (data from MRSA252)
    NWMN_2016(upp)uracil phosphoribosyltransferase  [1] (data from MRSA252)
    NWMN_0428ABC transporter substrate-binding protein  [1] (data from MRSA252)
    NWMN_0475cysteine synthase-like protein  [1] (data from MRSA252)
    NWMN_0481pyridoxal biosynthesis lyase PdxS  [1] (data from MRSA252)
    NWMN_0601hypothetical protein  [1] (data from MRSA252)
    NWMN_0619dihydroxyacetone kinase subunit DhaK  [1] (data from MRSA252)
    NWMN_0655MarR family regulatory protein  [1] (data from MRSA252)
    NWMN_0775hypothetical protein  [1] (data from MRSA252)
    NWMN_0776glycine cleavage system protein H  [1] (data from MRSA252)
    NWMN_0811hypothetical protein  [1] (data from MRSA252)
    NWMN_08543-oxoacyl-(acyl-carrier-protein) synthase II  [1] (data from MRSA252)
    NWMN_0885hypothetical protein  [1] (data from MRSA252)
    NWMN_0897lipoate-protein ligase A  [1] (data from MRSA252)
    NWMN_0949phosphocarrier protein HPr  [1] (data from MRSA252)
    NWMN_0950phosphoenolpyruvate-protein phosphatase  [1] (data from MRSA252)
    NWMN_0956hypothetical protein  [1] (data from MRSA252)
    NWMN_1263aconitate hydratase  [1] (data from MRSA252)
    NWMN_1434proline dipeptidase  [1] (data from MRSA252)
    NWMN_1516hypothetical protein  [1] (data from MRSA252)
    NWMN_1604universal stress protein family protein  [1] (data from MRSA252)
    NWMN_1643D-alanine aminotransferase  [1] (data from MRSA252)
    NWMN_1644dipeptidase PepV  [1] (data from MRSA252)
    NWMN_1672putative translaldolase  [1] (data from MRSA252)
    NWMN_1767ThiJ/PfpI family protein  [1] (data from MRSA252)
    NWMN_1857putative manganese-dependent inorganic pyrophosphatase  [1] (data from MRSA252)
    NWMN_2086alkaline shock protein 23  [1] (data from MRSA252)
    NWMN_2272zinc-containing alcohol dehydrogenase superfamily protein  [1] (data from MRSA252)
    NWMN_2503fructose-1,6-bisphosphate aldolase  [1] (data from MRSA252)
    NWMN_2504malate:quinone oxidoreductase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 2
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: 0.5
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.192
    • Ymax_pos: 35
    • Cmax: 0.244
    • Cmax_pos: 35
    • Smax: 0.354
    • Smax_pos: 2
    • Smean: 0.185
    • D: 0.189
  • predicted transmembrane helices (TMHMM): 2

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MFSLSFIVIAVIIVVALLILFSFVPIGLWISALAAGVHVGIGTLVGMRLRRVSPRKVIAPLIKAHKAGLALTTNQLESHYLAGGNVDRVVDANIAAQRADIDLPFERAAAIDLAGRDVLEAVQMSVNPKVIETPFIAGVAMNGIEVKAKARITVRANIARLVGGAGEETIIARVGEGIVSTIGSSKHHTEVLENPDNISKTVLSKGLDSGTAFEILSIDIADVDISKNIGADLQTEQALADKNIAQAKAEERRAMAVATEQEMKARVQEMHAKVVEAESEVPLAMAEALRSGNISVKDYYNLKNIEADTGMRNAINKRTDQSDDESPEH

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 1.49 1.50 1.51 1.52 1.53 1.54 1.55 1.56 1.57 1.58 1.59 1.60 1.61 1.62 1.63 1.64 1.65 1.66 1.67 1.68 1.69 1.70 1.71 1.72 1.73 1.74 1.75 1.76 1.77 1.78 1.79 1.80 1.81 1.82 1.83 1.84 1.85 1.86 1.87 1.88 1.89 1.90 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]