From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0516 [new locus tag: SACOL_RS02610 ]
  • pan locus tag?: SAUPAN002190000
  • symbol: SACOL0516
  • pan gene symbol?: treP
  • synonym:
  • product: PTS system, IIBC components

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL0516 [new locus tag: SACOL_RS02610 ]
  • symbol: SACOL0516
  • product: PTS system, IIBC components
  • replicon: chromosome
  • strand: +
  • coordinates: 520470..521897
  • length: 1428
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    ATGGCTGTAAAAAGAGAAGATGTAAAAGCCATCGTAACCGCTATTGGGGGAAAAGAAAAT
    CTTGAAGCTGCAACGCATTGTGTAACACGATTACGTTTAGTGCTGAAGGATGAAAGTAAA
    GTTGATAAAGACGCATTAAGTAATAACGCGTTGGTCAAGGGGCAGTTTAAAGCAGACCAT
    CAATATCAAATTGTCATTGGTCCAGGAACAGTCGATGAAGTGTATAAGCAGTTTATTGAT
    GAAACAGGTGCTCAAGAAGCTTCGAAAGATGAAGCGAAACAAGCAGCTGCACAAAAAGGG
    AATCCAGTACAACGTTTGATCAAATTGTTGGGGGATATTTTTATACCAATATTACCTGCG
    ATTGTGACAGCTGGTTTGTTAATGGGAATCAATAATTTACTTACAATGAAAGGTTTATTT
    GGTCCAAAAGCACTTATTGAGATGTATCCACAAATTGCTGATATTTCAAACATCATTAAT
    GTGATTGCGAGTACGGCATTTATTTTCTTACCAGCATTAATTGGTTGGAGTAGTATGCGT
    GTATTTGGTGGTAGTCCGATTCTAGGCATAGTCTTAGGTTTGATTTTAATGCATCCGCAA
    TTAGTATCTCAGTATGATTTGGCAAAAGGGAATATTCCGACGTGGAACTTATTTGGCTTA
    GAGATTAAGCAGTTGAATTACCAAGGTCAAGTGTTGCCAGTTTTAATTGCAGCTTACGTT
    CTAGCTAAAATTGAAAAAGGATTAAATAAAGTCGTTCACGATTCGATAAAAATGTTGGTC
    GTTGGACCCGTAGCGCTTTTAGTTACTGGATTTTTAGCATTTATTATCATTGGACCAGTT
    GCGTTATTGATTGGTACAGGTATTACATCTGGTGTTACATTTATATTCCAACATGCAGGA
    TGGCTTGGCGGAGCAATATATGGATTGTTATATGCACCACTTGTAATTACAGGACTACAC
    CATATGTTTTTAGCAGTAGATTTCCAATTGATGGGTAGCAGCTTAGGCGGTACGTATTTA
    TGGCCAATTGTTGCGATTTCCAATATTTGTCAGGGCTCTGCAGCATTTGGAGCATGGTTT
    GTCTATAAACGTCGTAAAATGGTTAAAGAAGAAGGCTTGGCATTAACATCTTGTATTTCT
    GGTATGTTAGGTGTTACTGAACCAGCCATGTTCGGTGTGAACTTACCTCTGAAATATCCA
    TTTATCGCTGCGATATCAACGTCTTGTGTATTGGGGGCAATCGTTGGTATGAATAACGTA
    CTTGGAAAAGTTGGTGTTGGTGGCGTGCCAGCATTCATTTCAATTCAAAAAGAATTTTGG
    CCAGTATATCTTATTGTGACAGCTATTGCTATTGTTGTACCATGTATACTAACAATTGTG
    ATGTCTCATTTTAGTAAACAAAAAGCGAAAGAAATTGTTGAAGATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1428

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL0516 [new locus tag: SACOL_RS02610 ]
  • symbol: SACOL0516
  • description: PTS system, IIBC components
  • length: 475
  • theoretical pI: 9.02815
  • theoretical MW: 50937.3
  • GRAVY: 0.623158

Function[edit | edit source]

  • TIGRFAM:
    PTS system, trehalose-specific IIBC component (TIGR01992; EC 2.7.1.69; HMM-score: 702.4)
    and 11 more
    PTS system, sucrose-specific IIBC component (TIGR01996; EC 2.7.1.69; HMM-score: 512.2)
    PTS system, beta-glucoside-specific IIABC component (TIGR01995; EC 2.7.1.69; HMM-score: 340.6)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids PTS system, maltose and glucose-specific subfamily, IIC component (TIGR00852; HMM-score: 234)
    Signal transduction Signal transduction PTS PTS system, maltose and glucose-specific subfamily, IIC component (TIGR00852; HMM-score: 234)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids PTS system, glucose-like IIB component (TIGR00826; EC 2.7.1.69; HMM-score: 82.6)
    Signal transduction Signal transduction PTS PTS system, glucose-like IIB component (TIGR00826; EC 2.7.1.69; HMM-score: 82.6)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids PTS system, N-acetylglucosamine-specific IIBC component (TIGR01998; EC 2.7.1.69; HMM-score: 44.9)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids PTS system, maltose and glucose-specific IIBC component (TIGR02004; EC 2.7.1.69; HMM-score: 37.9)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids PTS system, alpha-glucoside-specific IIBC component (TIGR02005; EC 2.7.1.69; HMM-score: 37.4)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids PTS system, glucose-specific IIBC component (TIGR02002; EC 2.7.1.69; HMM-score: 25.3)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids PTS system, IIBC component (TIGR02003; EC 2.7.1.69; HMM-score: 21.9)
  • TheSEED  :
    • PTS system, trehalose-specific IIB component (EC 2.7.1.69)
    • PTS system, trehalose-specific IIC component (EC 2.7.1.69)
    Carbohydrates Di- and oligosaccharides Trehalose Uptake and Utilization  PTS system, trehalose-specific IIB component (EC 2.7.1.69)
    and 1 more
    Carbohydrates Di- and oligosaccharides Trehalose Uptake and Utilization  PTS system, trehalose-specific IIC component (EC 2.7.1.69)
  • PFAM:
    PTS_EIIC (CL0493) PTS_EIIC; Phosphotransferase system, EIIC (PF02378; HMM-score: 142.7)
    and 2 more
    no clan defined PTS_EIIB; phosphotransferase system, EIIB (PF00367; HMM-score: 57.6)
    MotA_ExbB; MotA/TolQ/ExbB proton channel family (PF01618; HMM-score: 12.3)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 9
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular possibility: 0.17
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.010863
    • TAT(Tat/SPI): 0.001305
    • LIPO(Sec/SPII): 0.001767
  • predicted transmembrane helices (TMHMM): 9

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MAVKREDVKAIVTAIGGKENLEAATHCVTRLRLVLKDESKVDKDALSNNALVKGQFKADHQYQIVIGPGTVDEVYKQFIDETGAQEASKDEAKQAAAQKGNPVQRLIKLLGDIFIPILPAIVTAGLLMGINNLLTMKGLFGPKALIEMYPQIADISNIINVIASTAFIFLPALIGWSSMRVFGGSPILGIVLGLILMHPQLVSQYDLAKGNIPTWNLFGLEIKQLNYQGQVLPVLIAAYVLAKIEKGLNKVVHDSIKMLVVGPVALLVTGFLAFIIIGPVALLIGTGITSGVTFIFQHAGWLGGAIYGLLYAPLVITGLHHMFLAVDFQLMGSSLGGTYLWPIVAISNICQGSAAFGAWFVYKRRKMVKEEGLALTSCISGMLGVTEPAMFGVNLPLKYPFIAAISTSCVLGAIVGMNNVLGKVGVGGVPAFISIQKEFWPVYLIVTAIAIVVPCILTIVMSHFSKQKAKEIVED

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Integral membrane [1] [2]
  • quantitative data / protein copy number per cell:
  • interaction partners:
    SACOL1760(ackA)acetate kinase  [3] (data from MRSA252)
    SACOL1385(acnA)aconitate hydratase  [3] (data from MRSA252)
    SACOL0660(adhP)alcohol dehydrogenase  [3] (data from MRSA252)
    SACOL0452(ahpC)alkyl hydroperoxide reductase subunit C  [3] (data from MRSA252)
    SACOL2656(arcB2)ornithine carbamoyltransferase  [3] (data from MRSA252)
    SACOL0557(cysK)cysteine synthase  [3] (data from MRSA252)
    SACOL0002(dnaN)DNA polymerase III subunit beta  [3] (data from MRSA252)
    SACOL0842(eno)phosphopyruvate hydratase  [3] (data from MRSA252)
    SACOL1329(femC)glutamine synthetase  [3] (data from MRSA252)
    SACOL1782(fhs)formate--tetrahydrofolate ligase  [3] (data from MRSA252)
    SACOL0593(fusA)elongation factor G  [3] (data from MRSA252)
    SACOL0838(gapA1)glyceraldehyde 3-phosphate dehydrogenase  [3] (data from MRSA252)
    SACOL1734(gapA2)glyceraldehyde 3-phosphate dehydrogenase 2  [3] (data from MRSA252)
    SACOL1961(gatA)aspartyl/glutamyl-tRNA amidotransferase subunit A  [3] (data from MRSA252)
    SACOL1960(gatB)aspartyl/glutamyl-tRNA amidotransferase subunit B  [3] (data from MRSA252)
    SACOL0877(gcvH)glycine cleavage system protein H  [3] (data from MRSA252)
    SACOL2145(glmS)glucosamine--fructose-6-phosphate aminotransferase  [3] (data from MRSA252)
    SACOL1622(glyS)glycyl-tRNA synthetase  [3] (data from MRSA252)
    SACOL1554(gnd)6-phosphogluconate dehydrogenase  [3] (data from MRSA252)
    SACOL2016(groEL)chaperonin GroEL  [3] (data from MRSA252)
    SACOL0461(guaA)GMP synthase  [3] (data from MRSA252)
    SACOL1513(hup)DNA-binding protein HU  [3] (data from MRSA252)
    SACOL1741(icd)isocitrate dehydrogenase  [3] (data from MRSA252)
    SACOL1288(infB)translation initiation factor IF-2  [3] (data from MRSA252)
    SACOL0222(ldh1)L-lactate dehydrogenase  [3] (data from MRSA252)
    SACOL0562(lysS)lysyl-tRNA synthetase  [3] (data from MRSA252)
    SACOL2623(mqo2)malate:quinone oxidoreductase  [3] (data from MRSA252)
    SACOL2116(murAB)UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [3] (data from MRSA252)
    SACOL0582(nusG)transcription antitermination protein  [3] (data from MRSA252)
    SACOL1102(pdhA)pyruvate dehydrogenase complex E1 component subunit alpha  [3] (data from MRSA252)
    SACOL1103(pdhB)pyruvate dehydrogenase complex E1 component subunit beta  [3] (data from MRSA252)
    SACOL1104(pdhC)branched-chain alpha-keto acid dehydrogenase E2  [3] (data from MRSA252)
    SACOL1105(pdhD)dihydrolipoamide dehydrogenase  [3] (data from MRSA252)
    SACOL0204(pflB)formate acetyltransferase  [3] (data from MRSA252)
    SACOL1011(ppnK)inorganic polyphosphate/ATP-NAD kinase  [3] (data from MRSA252)
    SACOL1282(proS)prolyl-tRNA synthetase  [3] (data from MRSA252)
    SACOL1091(ptsH)phosphocarrier protein HPr  [3] (data from MRSA252)
    SACOL1745(pyk)pyruvate kinase  [3] (data from MRSA252)
    SACOL0584(rplA)50S ribosomal protein L1  [3] (data from MRSA252)
    SACOL2238(rplD)50S ribosomal protein L4  [3] (data from MRSA252)
    SACOL2227(rplE)50S ribosomal protein L5  [3] (data from MRSA252)
    SACOL0585(rplJ)50S ribosomal protein L10  [3] (data from MRSA252)
    SACOL0586(rplL)50S ribosomal protein L7/L12  [3] (data from MRSA252)
    SACOL2207(rplM)50S ribosomal protein L13  [3] (data from MRSA252)
    SACOL2220(rplO)50S ribosomal protein L15  [3] (data from MRSA252)
    SACOL2223(rplR)50S ribosomal protein L18  [3] (data from MRSA252)
    SACOL1702(rplU)50S ribosomal protein L21  [3] (data from MRSA252)
    SACOL2234(rplV)50S ribosomal protein L22  [3] (data from MRSA252)
    SACOL2237(rplW)50S ribosomal protein L23  [3] (data from MRSA252)
    SACOL0588(rpoB)DNA-directed RNA polymerase subunit beta  [3] (data from MRSA252)
    SACOL1274(rpsB)30S ribosomal protein S2  [3] (data from MRSA252)
    SACOL2233(rpsC)30S ribosomal protein S3  [3] (data from MRSA252)
    SACOL1769(rpsD)30S ribosomal protein S4  [3] (data from MRSA252)
    SACOL2222(rpsE)30S ribosomal protein S5  [3] (data from MRSA252)
    SACOL2214(rpsK)30S ribosomal protein S11  [3] (data from MRSA252)
    SACOL2230(rpsQ)30S ribosomal protein S17  [3] (data from MRSA252)
    SACOL2235(rpsS)30S ribosomal protein S19  [3] (data from MRSA252)
    SACOL1610(sodA2)superoxide dismutase  [3] (data from MRSA252)
    SACOL1449(sucA)2-oxoglutarate dehydrogenase E1 component  [3] (data from MRSA252)
    SACOL1448(sucB)dihydrolipoamide succinyltransferase  [3] (data from MRSA252)
    SACOL1262(sucC)succinyl-CoA synthetase subunit beta  [3] (data from MRSA252)
    SACOL1831(tal)translaldolase  [3] (data from MRSA252)
    SACOL1729(thrS)threonyl-tRNA synthetase  [3] (data from MRSA252)
    SACOL1722(tig)trigger factor  [3] (data from MRSA252)
    SACOL0840(tpiA)triosephosphate isomerase  [3] (data from MRSA252)
    SACOL1155(trxA)thioredoxin  [3] (data from MRSA252)
    SACOL1276(tsf)elongation factor Ts  [3] (data from MRSA252)
    SACOL0594(tuf)elongation factor Tu  [3] (data from MRSA252)
    SACOL2104(upp)uracil phosphoribosyltransferase  [3] (data from MRSA252)
    SACOL0426acetyl-CoA acetyltransferase  [3] (data from MRSA252)
    SACOL0688ABC transporter substrate-binding protein  [3] (data from MRSA252)
    SACOL0914FeS assembly ATPase SufC  [3] (data from MRSA252)
    SACOL1020hypothetical protein  [3] (data from MRSA252)
    SACOL1670hypothetical protein  [3] (data from MRSA252)
    SACOL2173alkaline shock protein 23  [3] (data from MRSA252)
    SACOL2412amino acid ABC transporter amino acid-binding protein  [3] (data from MRSA252)
    SACOL2561hydroxymethylglutaryl-CoA synthase  [3] (data from MRSA252)
    SACOL25691-pyrroline-5-carboxylate dehydrogenase  [3] (data from MRSA252)

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator: CcpA regulon
    CcpA(TF)important in Carbon catabolism; RegPrecise  

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  3. 3.00 3.01 3.02 3.03 3.04 3.05 3.06 3.07 3.08 3.09 3.10 3.11 3.12 3.13 3.14 3.15 3.16 3.17 3.18 3.19 3.20 3.21 3.22 3.23 3.24 3.25 3.26 3.27 3.28 3.29 3.30 3.31 3.32 3.33 3.34 3.35 3.36 3.37 3.38 3.39 3.40 3.41 3.42 3.43 3.44 3.45 3.46 3.47 3.48 3.49 3.50 3.51 3.52 3.53 3.54 3.55 3.56 3.57 3.58 3.59 3.60 3.61 3.62 3.63 3.64 3.65 3.66 3.67 3.68 3.69 3.70 3.71 3.72 3.73 3.74 3.75 3.76 3.77 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]