From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1023 [new locus tag: SACOL_RS05220 ]
  • pan locus tag?: SAUPAN003196000
  • symbol: murE
  • pan gene symbol?: murE
  • synonym:
  • product: UDP-N-acetylmuramoylalanyl-D-glutamate--L-lysine ligase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL1023 [new locus tag: SACOL_RS05220 ]
  • symbol: murE
  • product: UDP-N-acetylmuramoylalanyl-D-glutamate--L-lysine ligase
  • replicon: chromosome
  • strand: +
  • coordinates: 1032093..1033574
  • length: 1482
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    TTGGATGCAAGTACGTTGTTTAAGAAAGTAAAAGTAAAGCGTGTATTGGGTTCTTTAGAA
    CAACAAATAGATGATATCACTACTGATTCACGTACAGCGAGAGAAGGTAGCATTTTTGTC
    GCTTCAGTTGGATATACTGTAGACAGTCATAAGTTCTGTCAAAATGTAGCTGATCAAGGG
    TGTAAGTTGGTAGTGGTCAATAAAGAACAATCATTACCAGCTAACGTAACACAAGTGGTT
    GTGCCGGACACATTAAGAGTAGCTAGTATTCTAGCACACACATTATATGATTATCCGAGT
    CATCAGTTAGTGACATTTGGTGTAACGGGTACAAATGGTAAAACTTCTATTGCGACGATG
    ATTCATTTAATTCAAAGAAAGTTACAAAAAAATAGTGCATATTTAGGAACTAATGGTTTC
    CAAATTAATGAAACAAAGACAAAAGGTGCAAATACGACACCAGAAACAGTTTCTTTAACT
    AAGAAAATTAAAGAAGCAGTTGATGCAGGCGCTGAATCTATGACATTAGAAGTATCAAGC
    CATGGCTTAGTATTAGGACGACTGCGAGGCGTTGAATTTGACGTTGCAATATTTTCAAAT
    TTAACACAAGACCATTTAGATTTTCATGGCACAATGGAAGCATACGGACACGCGAAGTCT
    TTATTGTTTAGTCAATTAGGTGAAGATTTGTCGAAAGAAAAGTATGTCGTGTTAAACAAT
    GACGATTCATTTTCTGAGTATTTAAGAACAGTGACGCCTTATGAAGTATTTAGTTATGGA
    ATTGATGAGGAAGCCCAATTTATGGCTAAAAATATTCAAGAATCTTTACAAGGTGTCAGC
    TTTGATTTTGTAACGCCTTTTGGAACTTACCCAGTAAAATCGCCTTATGTTGGTAAGTTT
    AATATTTCTAATATTATGGCGGCAATGATTGCGGTGTGGAGTAAAGGTACATCTTTAGAA
    ACGATTATTAAAGCTGTTGAAAATTTAGAACCTGTTGAAGGGCGATTAGAAGTTTTAGAT
    CCTTCGTTACCTATTGATTTAATTATCGATTATGCACATACAGCTGATGGTATGAACAAA
    TTAATCGATGCAGTACAGCCTTTTGTAAAGCAAAAGTTGATATTTTTAGTTGGTATGGCA
    GGCGAACGTGATTTAACTAAAACGCCTGAAATGGGGCGAGTTGCCTGTCGTGCAGATTAT
    GTCATTTTCACACCGGATAATCCGGCAAATGATGACCCGAAAATGTTAACGGCAGAATTA
    GCCAAAGGTGCAACACATCAAAACTATATTGAATTTGATGATCGTGCAGAAGGGATAAAA
    CATGCAATTGACATAGCTGAGCCTGGGGATACTGTCGTTTTAGCATCAAAAGGAAGAGAA
    CCATATCAAATCATGCCAGGGCATATTAAGGTGCCACATCGAGATGATTTAATTGGCCTT
    GAAGCAGCTTACAAAAAGTTCGGTGGTGGCCCTGTTGATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1482

Protein[edit source | edit]

Protein Data Bank: 4C12
Protein Data Bank: 4C13

General[edit source | edit]

  • locus tag: SACOL1023 [new locus tag: SACOL_RS05220 ]
  • symbol: MurE
  • description: UDP-N-acetylmuramoylalanyl-D-glutamate--L-lysine ligase
  • length: 493
  • theoretical pI: 5.33961
  • theoretical MW: 54104.2
  • GRAVY: -0.1714

Function[edit source | edit]

  • reaction:
    EC 6.3.2.7?  ExPASy
    UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligaseATP + UDP-N-acetyl-alpha-D-muramoyl-L-alanyl-D-glutamate + L-lysine = ADP + phosphate + UDP-N-acetyl-alpha-D-muramoyl-L-alanyl-gamma-D-glutamyl-L-lysine
    EC 6.3.2.13?  ExPASy
    UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligaseATP + UDP-N-acetyl-alpha-D-muramoyl-L-alanyl-D-glutamate + meso-2,6-diaminoheptanedioate = ADP + phosphate + UDP-N-acetyl-alpha-D-muramoyl-L-alanyl-D-gamma-glutamyl-meso-2,6-diaminoheptanedioate
  • TIGRFAM:
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanUDP-N-acetylmuramyl-tripeptide synthetase (TIGR01085; HMM-score: 432)
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanUDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase (TIGR01143; EC 6.3.2.10; HMM-score: 135.4)
    Cellular processesCellular processesBiosynthesis of natural productscyanophycin synthetase (TIGR02068; EC 6.3.2.29,6.3.2.30; HMM-score: 95.5)
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanUDP-N-acetylmuramate--L-alanine ligase (TIGR01082; EC 6.3.2.8; HMM-score: 90.5)
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanUDP-N-acetylmuramoylalanine--D-glutamate ligase (TIGR01087; EC 6.3.2.9; HMM-score: 80.3)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersFolic acidbifunctional protein FolC (TIGR01499; EC 6.3.2.-; HMM-score: 41.6)
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanUDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase (TIGR01081; HMM-score: 26.4)
  • TheSEED:  
    Cell Wall and CapsuleCell Wall and Capsule - no subcategoryPeptidoglycan biosynthesis--gjo UDP-N-acetylmuramoylalanyl-D-glutamate--L-lysine ligase (EC 6.3.2.7) 
  • PFAM:
    no clan definedMur_ligase_M; Mur ligase middle domain (PF08245; HMM-score: 179.9)
    Mur_ligase_C; Mur ligase family, glutamate ligase domain (PF02875; HMM-score: 65.6)
    NADP_Rossmann (CL0063) Mur_ligase; Mur ligase family, catalytic domain (PF01225; HMM-score: 29.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SACOL1760(ackA)acetate kinase  [1] (data from MRSA252)
    SACOL0660(adhP)alcohol dehydrogenase  [1] (data from MRSA252)
    SACOL0452(ahpC)alkyl hydroperoxide reductase subunit C  [1] (data from MRSA252)
    SACOL1478(ald1)alanine dehydrogenase  [1] (data from MRSA252)
    SACOL2657(arcA)arginine deiminase  [1] (data from MRSA252)
    SACOL2656(arcB2)ornithine carbamoyltransferase  [1] (data from MRSA252)
    SACOL2654(arcC2)carbamate kinase  [1] (data from MRSA252)
    SACOL1494(asnC)asparaginyl-tRNA synthetase  [1] (data from MRSA252)
    SACOL1685(aspS)aspartyl-tRNA synthetase  [1] (data from MRSA252)
    SACOL1786(ccpA)catabolite control protein A  [1] (data from MRSA252)
    SACOL0557(cysK)cysteine synthase  [1] (data from MRSA252)
    SACOL2074(ddl)D-alanyl-alanine synthetase A  [1] (data from MRSA252)
    SACOL2130(deoD)purine nucleoside phosphorylase  [1] (data from MRSA252)
    SACOL1637(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    SACOL1587(efp)elongation factor P  [1] (data from MRSA252)
    SACOL0842(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    SACOL0634(eutD)phosphotransacetylase  [1] (data from MRSA252)
    SACOL0988(fabF)3-oxoacyl-ACP synthase  [1] (data from MRSA252)
    SACOL1245(fabG1)3-oxoacyl-ACP reductase  [1] (data from MRSA252)
    SACOL2117(fbaA)fructose-bisphosphate aldolase  [1] (data from MRSA252)
    SACOL2622(fdaB)fructose-1,6-bisphosphate aldolase  [1] (data from MRSA252)
    SACOL1329(femC)glutamine synthetase  [1] (data from MRSA252)
    SACOL1782(fhs)formate--tetrahydrofolate ligase  [1] (data from MRSA252)
    SACOL1072(folD)bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase  [1] (data from MRSA252)
    SACOL1278(frr)ribosome recycling factor  [1] (data from MRSA252)
    SACOL1199(ftsZ)cell division protein FtsZ  [1] (data from MRSA252)
    SACOL0593(fusA)elongation factor G  [1] (data from MRSA252)
    SACOL0838(gapA1)glyceraldehyde 3-phosphate dehydrogenase  [1] (data from MRSA252)
    SACOL1734(gapA2)glyceraldehyde 3-phosphate dehydrogenase 2  [1] (data from MRSA252)
    SACOL1961(gatA)aspartyl/glutamyl-tRNA amidotransferase subunit A  [1] (data from MRSA252)
    SACOL1960(gatB)aspartyl/glutamyl-tRNA amidotransferase subunit B  [1] (data from MRSA252)
    SACOL0877(gcvH)glycine cleavage system protein H  [1] (data from MRSA252)
    SACOL2145(glmS)glucosamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    SACOL1320(glpK)glycerol kinase  [1] (data from MRSA252)
    SACOL0961(gluD)glutamate dehydrogenase  [1] (data from MRSA252)
    SACOL1622(glyS)glycyl-tRNA synthetase  [1] (data from MRSA252)
    SACOL1554(gnd)6-phosphogluconate dehydrogenase  [1] (data from MRSA252)
    SACOL2415(gpmA)phosphoglyceromutase  [1] (data from MRSA252)
    SACOL2016(groEL)chaperonin GroEL  [1] (data from MRSA252)
    SACOL0461(guaA)GMP synthase  [1] (data from MRSA252)
    SACOL0460(guaB)inosine-5'-monophosphate dehydrogenase  [1] (data from MRSA252)
    SACOL1513(hup)DNA-binding protein HU  [1] (data from MRSA252)
    SACOL1741(icd)isocitrate dehydrogenase  [1] (data from MRSA252)
    SACOL1206(ileS)isoleucyl-tRNA synthetase  [1] (data from MRSA252)
    SACOL0600(ilvE)branched-chain amino acid aminotransferase  [1] (data from MRSA252)
    SACOL1288(infB)translation initiation factor IF-2  [1] (data from MRSA252)
    SACOL0240(ispD)2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase  [1] (data from MRSA252)
    SACOL0222(ldh1)L-lactate dehydrogenase  [1] (data from MRSA252)
    SACOL2618(ldh2)L-lactate dehydrogenase  [1] (data from MRSA252)
    SACOL1054(menB)naphthoate synthase  [1] (data from MRSA252)
    SACOL2272(modA)molybdenum ABC transporter molybdenum-binding protein ModA  [1] (data from MRSA252)
    SACOL2623(mqo2)malate:quinone oxidoreductase  [1] (data from MRSA252)
    SACOL1509(ndk)nucleoside diphosphate kinase  [1] (data from MRSA252)
    SACOL0746(norR)MarR family transcriptional regulator  [1] (data from MRSA252)
    SACOL0793(nrdF)ribonucleotide-diphosphate reductase subunit beta  [1] (data from MRSA252)
    SACOL1285(nusA)transcription elongation factor NusA  [1] (data from MRSA252)
    SACOL2615(panB)3-methyl-2-oxobutanoate hydroxymethyltransferase  [1] (data from MRSA252)
    SACOL1838(pckA)phosphoenolpyruvate carboxykinase  [1] (data from MRSA252)
    SACOL1102(pdhA)pyruvate dehydrogenase complex E1 component subunit alpha  [1] (data from MRSA252)
    SACOL1105(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    SACOL2128(pdp)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    SACOL1005(pepF)oligoendopeptidase F  [1] (data from MRSA252)
    SACOL1746(pfkA)6-phosphofructokinase  [1] (data from MRSA252)
    SACOL0204(pflB)formate acetyltransferase  [1] (data from MRSA252)
    SACOL0966(pgi)glucose-6-phosphate isomerase  [1] (data from MRSA252)
    SACOL0839(pgk)phosphoglycerate kinase  [1] (data from MRSA252)
    SACOL0841(pgm)phosphoglyceromutase  [1] (data from MRSA252)
    SACOL1293(pnp)polynucleotide phosphorylase/polyadenylase  [1] (data from MRSA252)
    SACOL1982(ppaC)manganese-dependent inorganic pyrophosphatase  [1] (data from MRSA252)
    SACOL1282(proS)prolyl-tRNA synthetase  [1] (data from MRSA252)
    SACOL1091(ptsH)phosphocarrier protein HPr  [1] (data from MRSA252)
    SACOL1092(ptsI)phosphoenolpyruvate-protein phosphotransferase  [1] (data from MRSA252)
    SACOL1816(putA)proline dehydrogenase  [1] (data from MRSA252)
    SACOL1745(pyk)pyruvate kinase  [1] (data from MRSA252)
    SACOL1213(pyrC)dihydroorotase  [1] (data from MRSA252)
    SACOL2119(pyrG)CTP synthetase  [1] (data from MRSA252)
    SACOL0584(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    SACOL2236(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    SACOL2238(rplD)50S ribosomal protein L4  [1] (data from MRSA252)
    SACOL2227(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    SACOL2224(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    SACOL0015(rplI)50S ribosomal protein L9  [1] (data from MRSA252)
    SACOL0585(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    SACOL0583(rplK)50S ribosomal protein L11  [1] (data from MRSA252)
    SACOL0586(rplL)50S ribosomal protein L7/L12  [1] (data from MRSA252)
    SACOL2207(rplM)50S ribosomal protein L13  [1] (data from MRSA252)
    SACOL2220(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    SACOL2212(rplQ)50S ribosomal protein L17  [1] (data from MRSA252)
    SACOL2223(rplR)50S ribosomal protein L18  [1] (data from MRSA252)
    SACOL1257(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    SACOL1725(rplT)50S ribosomal protein L20  [1] (data from MRSA252)
    SACOL1702(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    SACOL2234(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    SACOL2237(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    SACOL2228(rplX)50S ribosomal protein L24  [1] (data from MRSA252)
    SACOL0545(rplY)50S ribosomal protein L25/general stress protein Ctc  [1] (data from MRSA252)
    SACOL2221(rpmD)50S ribosomal protein L30  [1] (data from MRSA252)
    SACOL2213(rpoA)DNA-directed RNA polymerase subunit alpha  [1] (data from MRSA252)
    SACOL0588(rpoB)DNA-directed RNA polymerase subunit beta  [1] (data from MRSA252)
    SACOL0589(rpoC)DNA-directed RNA polymerase subunit beta'  [1] (data from MRSA252)
    SACOL1516(rpsA)30S ribosomal protein S1  [1] (data from MRSA252)
    SACOL1274(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    SACOL2233(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    SACOL1769(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    SACOL2222(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SACOL0437(rpsF)30S ribosomal protein S6  [1] (data from MRSA252)
    SACOL0592(rpsG)30S ribosomal protein S7  [1] (data from MRSA252)
    SACOL2225(rpsH)30S ribosomal protein S8  [1] (data from MRSA252)
    SACOL2206(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    SACOL2240(rpsJ)30S ribosomal protein S10  [1] (data from MRSA252)
    SACOL2214(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    SACOL2215(rpsM)30S ribosomal protein S13  [1] (data from MRSA252)
    SACOL1292(rpsO)30S ribosomal protein S15  [1] (data from MRSA252)
    SACOL1254(rpsP)30S ribosomal protein S16  [1] (data from MRSA252)
    SACOL2230(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    SACOL2235(rpsS)30S ribosomal protein S19  [1] (data from MRSA252)
    SACOL2056(rsbV)anti-anti-sigma factor RsbV  [1] (data from MRSA252)
    SACOL2055(rsbW)serine-protein kinase RsbW  [1] (data from MRSA252)
    SACOL1610(sodA2)superoxide dismutase  [1] (data from MRSA252)
    SACOL0095(spa)immunoglobulin G binding protein A precursor  [1] (data from MRSA252)
    SACOL0541(spoVG)regulatory protein SpoVG  [1] (data from MRSA252)
    SACOL1449(sucA)2-oxoglutarate dehydrogenase E1 component  [1] (data from MRSA252)
    SACOL1262(sucC)succinyl-CoA synthetase subunit beta  [1] (data from MRSA252)
    SACOL1263(sucD)succinyl-CoA synthetase subunit alpha  [1] (data from MRSA252)
    SACOL1831(tal)translaldolase  [1] (data from MRSA252)
    SACOL1722(tig)trigger factor  [1] (data from MRSA252)
    SACOL1377(tkt)transketolase  [1] (data from MRSA252)
    SACOL0840(tpiA)triosephosphate isomerase  [1] (data from MRSA252)
    SACOL1155(trxA)thioredoxin  [1] (data from MRSA252)
    SACOL1276(tsf)elongation factor Ts  [1] (data from MRSA252)
    SACOL0594(tuf)elongation factor Tu  [1] (data from MRSA252)
    SACOL2104(upp)uracil phosphoribosyltransferase  [1] (data from MRSA252)
    SACOL1549(zwf)glucose-6-phosphate 1-dehydrogenase  [1] (data from MRSA252)
    SACOL0426acetyl-CoA acetyltransferase  [1] (data from MRSA252)
    SACOL0455hypothetical protein  [1] (data from MRSA252)
    SACOL0457hypothetical protein  [1] (data from MRSA252)
    SACOL0521hypothetical protein  [1] (data from MRSA252)
    SACOL0564pyridoxal biosynthesis lyase PdxS  [1] (data from MRSA252)
    SACOL05962-amino-3-ketobutyrate coenzyme A ligase  [1] (data from MRSA252)
    SACOL0633heme peroxidase  [1] (data from MRSA252)
    SACOL0688ABC transporter substrate-binding protein  [1] (data from MRSA252)
    SACOL0707dihydroxyacetone kinase subunit DhaK  [1] (data from MRSA252)
    SACOL0731LysR family transcriptional regulator  [1] (data from MRSA252)
    SACOL0742hypothetical protein  [1] (data from MRSA252)
    SACOL0815ribosomal subunit interface protein  [1] (data from MRSA252)
    SACOL0861CSD family cold shock protein  [1] (data from MRSA252)
    SACOL0875thioredoxin  [1] (data from MRSA252)
    SACOL0931HAD superfamily hydrolase  [1] (data from MRSA252)
    SACOL0944NADH dehydrogenase  [1] (data from MRSA252)
    SACOL0975coenzyme A disulfide reductase  [1] (data from MRSA252)
    SACOL1020hypothetical protein  [1] (data from MRSA252)
    SACOL1457PTS system, IIA component  [1] (data from MRSA252)
    SACOL1593glycine dehydrogenase subunit 2  [1] (data from MRSA252)
    SACOL1670hypothetical protein  [1] (data from MRSA252)
    SACOL1759universal stress protein  [1] (data from MRSA252)
    SACOL1787bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase  [1] (data from MRSA252)
    SACOL1792hypothetical protein  [1] (data from MRSA252)
    SACOL1801dipeptidase PepV  [1] (data from MRSA252)
    SACOL1952ferritins family protein  [1] (data from MRSA252)
    SACOL1992hypothetical protein  [1] (data from MRSA252)
    SACOL2000hypothetical protein  [1] (data from MRSA252)
    SACOL2173alkaline shock protein 23  [1] (data from MRSA252)
    SACOL2296glycerate dehydrogenase  [1] (data from MRSA252)
    SACOL2367alcohol dehydrogenase, zinc-containing  [1] (data from MRSA252)
    SACOL2488short chain dehydrogenase/reductase oxidoreductase  [1] (data from MRSA252)
    SACOL25691-pyrroline-5-carboxylate dehydrogenase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.203
    • Ymax_pos: 11
    • Cmax: 0.114
    • Cmax_pos: 52
    • Smax: 0.607
    • Smax_pos: 2
    • Smean: 0.369
    • D: 0.268
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MDASTLFKKVKVKRVLGSLEQQIDDITTDSRTAREGSIFVASVGYTVDSHKFCQNVADQGCKLVVVNKEQSLPANVTQVVVPDTLRVASILAHTLYDYPSHQLVTFGVTGTNGKTSIATMIHLIQRKLQKNSAYLGTNGFQINETKTKGANTTPETVSLTKKIKEAVDAGAESMTLEVSSHGLVLGRLRGVEFDVAIFSNLTQDHLDFHGTMEAYGHAKSLLFSQLGEDLSKEKYVVLNNDDSFSEYLRTVTPYEVFSYGIDEEAQFMAKNIQESLQGVSFDFVTPFGTYPVKSPYVGKFNISNIMAAMIAVWSKGTSLETIIKAVENLEPVEGRLEVLDPSLPIDLIIDYAHTADGMNKLIDAVQPFVKQKLIFLVGMAGERDLTKTPEMGRVACRADYVIFTPDNPANDDPKMLTAELAKGATHQNYIEFDDRAEGIKHAIDIAEPGDTVVLASKGREPYQIMPGHIKVPHRDDLIGLEAAYKKFGGGPVD

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [2] [3] [4]
    quantitative data / protein copy number per cell: 321 [5]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: 24.91 h [6]

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.000 1.001 1.002 1.003 1.004 1.005 1.006 1.007 1.008 1.009 1.010 1.011 1.012 1.013 1.014 1.015 1.016 1.017 1.018 1.019 1.020 1.021 1.022 1.023 1.024 1.025 1.026 1.027 1.028 1.029 1.030 1.031 1.032 1.033 1.034 1.035 1.036 1.037 1.038 1.039 1.040 1.041 1.042 1.043 1.044 1.045 1.046 1.047 1.048 1.049 1.050 1.051 1.052 1.053 1.054 1.055 1.056 1.057 1.058 1.059 1.060 1.061 1.062 1.063 1.064 1.065 1.066 1.067 1.068 1.069 1.070 1.071 1.072 1.073 1.074 1.075 1.076 1.077 1.078 1.079 1.080 1.081 1.082 1.083 1.084 1.085 1.086 1.087 1.088 1.089 1.090 1.091 1.092 1.093 1.094 1.095 1.096 1.097 1.098 1.099 1.100 1.101 1.102 1.103 1.104 1.105 1.106 1.107 1.108 1.109 1.110 1.111 1.112 1.113 1.114 1.115 1.116 1.117 1.118 1.119 1.120 1.121 1.122 1.123 1.124 1.125 1.126 1.127 1.128 1.129 1.130 1.131 1.132 1.133 1.134 1.135 1.136 1.137 1.138 1.139 1.140 1.141 1.142 1.143 1.144 1.145 1.146 1.147 1.148 1.149 1.150 1.151 1.152 1.153 1.154 1.155 1.156 1.157 1.158 1.159 1.160 1.161 1.162 1.163 1.164 1.165 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  2. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  3. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J. Proteome Res.: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  4. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  5. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  6. Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
    Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
    Mol. Cell Proteomics: 2012, 11(9);558-70
    [PubMed:22556279] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]

A M Ludovice, S W Wu, H de Lencastre
Molecular cloning and DNA sequencing of the Staphylococcus aureus UDP-N-acetylmuramyl tripeptide synthetase (murE) gene, essential for the optimal expression of methicillin resistance.
Microb. Drug Resist.: 1998, 4(2);85-90
[PubMed:9650993] [WorldCat.org] [DOI] (P p)