From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1101 [new locus tag: SA_RS06240 ]
  • pan locus tag?: SAUPAN003558000
  • symbol: pyrH
  • pan gene symbol?: pyrH
  • synonym:
  • product: uridylate kinase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1101 [new locus tag: SA_RS06240 ]
  • symbol: pyrH
  • product: uridylate kinase
  • replicon: chromosome
  • strand: +
  • coordinates: 1247166..1247888
  • length: 723
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGGCTCAAATTTCTAAATATAAACGTGTAGTTTTGAAACTAAGTGGTGAAGCGTTAGCT
    GGAGAAAAAGGATTTGGCATAAATCCAGTAATTATTAAAAGTGTTGCTGAGCAAGTGGCT
    GAAGTTGCTAAAATGGACTGTGAAATCGCAGTAATCGTTGGTGGCGGAAACATTTGGAGA
    GGTAAAACAGGTAGTGACTTAGGTATGGACCGTGGAACTGCTGATTACATGGGTATGCTT
    GCAACTGTAATGAATGCCTTAGCATTACAAGATAGTTTAGAACAATTGGATTGTGATACA
    CGAGTATTAACATCTATTGAAATGAAGCAAGTGGCTGAACCTTATATTCGTCGTCGTGCA
    ATTAGACACTTAGAAAAGAAACGCGTAGTTATTTTTGCTGCAGGTATTGGAAACCCATAC
    TTCTCTACAGATACTACAGCGGCATTACGTGCTGCAGAAGTTGAAGCAGATGTTATTTTA
    ATGGGCAAAAATAATGTAGATGGTGTATATTCTGCAGATCCTAAAGTAAACAAAGATGCG
    GTAAAATATGAACATTTAACGCATATTCAAATGCTTCAAGAAGGTTTACAAGTAATGGAT
    TCAACAGCATCCTCATTCTGTATGGATAATAACATTCCGTTAACTGTTTTCTCTATTATG
    GAAGAAGGGAATATTAAACGTGCTGTTATGGGTGAAAAGATAGGTACGTTAATTACAAAA
    TAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    723

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1101 [new locus tag: SA_RS06240 ]
  • symbol: PyrH
  • description: uridylate kinase
  • length: 240
  • theoretical pI: 6.28636
  • theoretical MW: 26145.2
  • GRAVY: -0.00458333

Function[edit source | edit]

  • reaction:
    EC 2.7.4.22?  ExPASy
    UMP kinaseATP + UMP = ADP + UDP
  • TIGRFAM:
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesNucleotide and nucleoside interconversionsUMP kinase (TIGR02075; EC 2.7.4.22; HMM-score: 345.7)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesNucleotide and nucleoside interconversionsputative uridylate kinase (TIGR02076; EC 2.7.4.-; HMM-score: 93)
    MetabolismAmino acid biosynthesisAspartate familyaspartate kinase (TIGR00657; EC 2.7.2.4; HMM-score: 37)
    MetabolismAmino acid biosynthesisAspartate familyaspartate kinase, monofunctional class (TIGR00656; EC 2.7.2.4; HMM-score: 32)
    MetabolismAmino acid biosynthesisGlutamate familyglutamate 5-kinase (TIGR01027; EC 2.7.2.11; HMM-score: 27.5)
  • TheSEED:  
    CBSS-312309.3.peg.1965 Uridine monophosphate kinase (EC 2.7.4.22) 
  • PFAM:
    no clan definedAA_kinase; Amino acid kinase family (PF00696; HMM-score: 96.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA0033(aadD)kanamycin nucleotidyltransferase  [1] (data from MRSA252)
    SA1533(ackA)acetate kinase  [1] (data from MRSA252)
    SA0562(adh1)alcohol dehydrogenase  [1] (data from MRSA252)
    SA2027(adk)adenylate kinase  [1] (data from MRSA252)
    SA0366(ahpC)alkyl hydroperoxide reductase  [1] (data from MRSA252)
    SA0365(ahpF)alkyl hydroperoxide reductase  [1] (data from MRSA252)
    SA1446(alaS)alanyl-tRNA synthetase  [1] (data from MRSA252)
    SA1531(ald)alanine dehydrogenase  [1] (data from MRSA252)
    SA0162(aldA)hypothetical protein  [1] (data from MRSA252)
    SA2428(arcA)arginine deiminase  [1] (data from MRSA252)
    SA2427(arcB)ornithine carbamoyltransferase  [1] (data from MRSA252)
    SA2425(arcC)carbamate kinase  [1] (data from MRSA252)
    SA0564(argS)arginyl-tRNA synthetase  [1] (data from MRSA252)
    SA1287(asnC)asparaginyl-tRNA synthetase  [1] (data from MRSA252)
    SA1984(asp23)alkaline shock protein 23  [1] (data from MRSA252)
    SA1456(aspS)aspartyl-tRNA synthetase  [1] (data from MRSA252)
    SA0032(bleO)bleomycin resistance protein  [1] (data from MRSA252)
    SA1046(carB)carbamoyl phosphate synthase large subunit  [1] (data from MRSA252)
    SA1557(ccpA)catabolite control protein A  [1] (data from MRSA252)
    SA0831(cdr)coenzyme A disulfide reductase  [1] (data from MRSA252)
    SA1184(citB)aconitate hydratase  [1] (data from MRSA252)
    SA1517(citC)isocitrate dehydrogenase  [1] (data from MRSA252)
    SA1518(citZ)citrate synthase  [1] (data from MRSA252)
    SA0483(clpC)endopeptidase  [1] (data from MRSA252)
    SA0723(clpP)ATP-dependent Clp protease proteolytic subunit  [1] (data from MRSA252)
    SA1498(clpX)ATP-dependent protease ATP-binding subunit ClpX  [1] (data from MRSA252)
    SA1309(cmk)cytidylate kinase  [1] (data from MRSA252)
    SA1098(codY)transcriptional repressor CodY  [1] (data from MRSA252)
    SA1234(cspA)cold-shock protein CspA  [1] (data from MRSA252)
    SA0471(cysK)hypothetical protein  [1] (data from MRSA252)
    SA2312(ddh)D-lactate dehydrogenase  [1] (data from MRSA252)
    SA1887(ddl)D-alanyl-alanine synthetase A  [1] (data from MRSA252)
    SA0942(def)peptide deformylase  [1] (data from MRSA252)
    SA1940(deoD)purine nucleoside phosphorylase  [1] (data from MRSA252)
    SA0793(dltA)D-alanine--poly(phosphoribitol) ligase subunit 1  [1] (data from MRSA252)
    SA0795(dltC)D-alanine--poly(phosphoribitol) ligase subunit 2  [1] (data from MRSA252)
    SA1409(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    SA0002(dnaN)DNA polymerase III subunit beta  [1] (data from MRSA252)
    SA1941(dps)general stress protein 20U  [1] (data from MRSA252)
    SA0133(dra)deoxyribose-phosphate aldolase  [1] (data from MRSA252)
    SA0134(drm)phosphopentomutase  [1] (data from MRSA252)
    SA0731(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    SA0545(eutD)phosphotransacetylase  [1] (data from MRSA252)
    SA0843(fab)3-oxoacyl-ACP synthase  [1] (data from MRSA252)
    SA1073(fabD)malonyl CoA-ACP transacylase  [1] (data from MRSA252)
    SA1074(fabG)3-oxoacyl-ACP reductase  [1] (data from MRSA252)
    SA0842(FabH)3-oxoacyl-ACP synthase  [1] (data from MRSA252)
    SA0869(fabI)enoyl-ACP reductase  [1] (data from MRSA252)
    SA1901(fabZ)(3R)-hydroxymyristoyl-ACP dehydratase  [1] (data from MRSA252)
    SA1927(fbaA)fructose-bisphosphate aldolase  [1] (data from MRSA252)
    SA1553(fhs)formate--tetrahydrofolate ligase  [1] (data from MRSA252)
    SA0915(folD)bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase  [1] (data from MRSA252)
    SA1102(frr)ribosome recycling factor  [1] (data from MRSA252)
    SA1028(ftsA)cell division protein  [1] (data from MRSA252)
    SA1029(ftsZ)cell division protein FtsZ  [1] (data from MRSA252)
    SA0505(fus)elongation factor G  [1] (data from MRSA252)
    SA0727(gap)glyceraldehyde-3-phosphate dehydrogenase  [1] (data from MRSA252)
    SA1510(gapB)glyceraldehyde 3-phosphate dehydrogenase 2  [1] (data from MRSA252)
    SA1716(gatA)aspartyl/glutamyl-tRNA amidotransferase subunit A  [1] (data from MRSA252)
    SA1715(gatB)aspartyl/glutamyl-tRNA amidotransferase subunit B  [1] (data from MRSA252)
    SA1367(gcvT)glycine cleavage system aminomethyltransferase T  [1] (data from MRSA252)
    SA1965(glmM)phosphoglucosamine mutase  [1] (data from MRSA252)
    SA1959(glmS)glucosamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    SA1150(glnA)glutamine-ammonia ligase  [1] (data from MRSA252)
    SA0486(gltX)glutamyl-tRNA synthetase  [1] (data from MRSA252)
    SA1394(glyS)glycyl-tRNA synthetase  [1] (data from MRSA252)
    SA1342(gnd)6-phosphogluconate dehydrogenase  [1] (data from MRSA252)
    SA2204(gpmA)phosphoglyceromutase  [1] (data from MRSA252)
    SA1438(greA)transcription elongation factor GreA  [1] (data from MRSA252)
    SA1836(groEL)molecular chaperone GroEL  [1] (data from MRSA252)
    SA1410(grpE)heat shock protein GrpE  [1] (data from MRSA252)
    SA0376(guaA)GMP synthase  [1] (data from MRSA252)
    SA0375(guaB)inositol-monophosphate dehydrogenase  [1] (data from MRSA252)
    SA0819(gudB)NAD-specific glutamate dehydrogenase  [1] (data from MRSA252)
    SA1656(hit)cell-cycle regulation Hit-like protein  [1] (data from MRSA252)
    SA1305(hu)DNA-binding protein II  [1] (data from MRSA252)
    SA1036(ileS)isoleucyl-tRNA synthetase  [1] (data from MRSA252)
    SA0512(ilvE)branched-chain amino acid aminotransferase  [1] (data from MRSA252)
    SA1112(infB)translation initiation factor IF-2  [1] (data from MRSA252)
    SA1504(infC)translation initiation factor IF-3  [1] (data from MRSA252)
    SA0245(ispD)2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase  [1] (data from MRSA252)
    SA1170(katA)catalase  [1] (data from MRSA252)
    SA0232(lctE)L-lactate dehydrogenase  [1] (data from MRSA252)
    SA1579(leuS)leucyl-tRNA synthetase  [1] (data from MRSA252)
    SA0475(lysS)lysyl-tRNA synthetase  [1] (data from MRSA252)
    SA0898(menB)naphthoate synthase  [1] (data from MRSA252)
    SA1608(metK)S-adenosylmethionine synthetase  [1] (data from MRSA252)
    SA0448(metS)methionyl-tRNA synthetase  [1] (data from MRSA252)
    SA2400(mqo2)malate:quinone oxidoreductase  [1] (data from MRSA252)
    SA1963(mtlD)mannitol-1-phosphate 5-dehydrogenase  [1] (data from MRSA252)
    SA1902(murA)UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [1] (data from MRSA252)
    SA1561(murC)UDP-N-acetylmuramate--L-alanine ligase  [1] (data from MRSA252)
    SA1926(murZ)UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [1] (data from MRSA252)
    SA2334(mvaS)3-hydroxy-3-methylglutaryl-CoA synthase  [1] (data from MRSA252)
    SA1301(ndk)nucleoside diphosphate kinase  [1] (data from MRSA252)
    SA0686(nrdE)ribonucleotide-diphosphate reductase subunit alpha  [1] (data from MRSA252)
    SA0687(nrdF)ribonucleotide-diphosphate reductase subunit beta  [1] (data from MRSA252)
    SA1109(nusA)transcription elongation factor NusA  [1] (data from MRSA252)
    SA0494(nusG)transcription antitermination protein  [1] (data from MRSA252)
    SA1244(odhB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    SA2392(panB)3-methyl-2-oxobutanoate hydroxymethyltransferase  [1] (data from MRSA252)
    SA1609(pckA)phosphoenolpyruvate carboxykinase  [1] (data from MRSA252)
    SA0943-1(pdhA)pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SA0944(pdhB)pyruvate dehydrogenase E1 component subunit beta  [1] (data from MRSA252)
    SA0945(pdhC)branched-chain alpha-keto acid dehydrogenase E2 subunit  [1] (data from MRSA252)
    SA0946(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    SA1938(pdp)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    SA1521(pfkA)6-phosphofructokinase  [1] (data from MRSA252)
    SA0218(pflB)formate acetyltransferase  [1] (data from MRSA252)
    SA0823(pgi)glucose-6-phosphate isomerase  [1] (data from MRSA252)
    SA0728(pgk)phosphoglycerate kinase  [1] (data from MRSA252)
    SA0730(pgm)phosphoglyceromutase  [1] (data from MRSA252)
    SA2435(pmi)mannose-6-phosphate isomerase  [1] (data from MRSA252)
    SA1117(pnpA)polynucleotide phosphorylase  [1] (data from MRSA252)
    SA1106(proS)prolyl-tRNA synthetase  [1] (data from MRSA252)
    SA0458(prs)ribose-phosphate pyrophosphokinase  [1] (data from MRSA252)
    SA0934(ptsH)phosphocarrier protein HPr  [1] (data from MRSA252)
    SA0935(ptsI)phosphoenolpyruvate-protein phosphatase  [1] (data from MRSA252)
    SA1520(pykA)pyruvate kinase  [1] (data from MRSA252)
    SA1044(pyrC)dihydroorotase  [1] (data from MRSA252)
    SA1048(pyrE)orotate phosphoribosyltransferase  [1] (data from MRSA252)
    SA1929(pyrG)CTP synthetase  [1] (data from MRSA252)
    SA2341(rocA)1-pyrroline-5-carboxylate dehydrogenase  [1] (data from MRSA252)
    SA0496(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    SA2044(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    SA2047(rplC)50S ribosomal protein L3  [1] (data from MRSA252)
    SA2046(rplD)50S ribosomal protein L4  [1] (data from MRSA252)
    SA2035(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    SA2033(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    SA0014(rplI)50S ribosomal protein L9  [1] (data from MRSA252)
    SA0497(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    SA0495(rplK)50S ribosomal protein L11  [1] (data from MRSA252)
    SA0498(rplL)50S ribosomal protein L7/L12  [1] (data from MRSA252)
    SA2017(rplM)50S ribosomal protein L13  [1] (data from MRSA252)
    SA2029(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    SA2022(rplQ)50S ribosomal protein L17  [1] (data from MRSA252)
    SA1084(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    SA1502(rplT)50S ribosomal protein L20  [1] (data from MRSA252)
    SA1473(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    SA2042(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    SA2045(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    SA2036(rplX)50S ribosomal protein L24  [1] (data from MRSA252)
    SA0459(rplY)50S ribosomal protein L25  [1] (data from MRSA252)
    SA2030(rpmD)50S ribosomal protein L30  [1] (data from MRSA252)
    SA1922(rpmE2)50S ribosomal protein L31  [1] (data from MRSA252)
    SA1503(rpmI)50S ribosomal protein L35  [1] (data from MRSA252)
    SA2023(rpoA)DNA-directed RNA polymerase subunit alpha  [1] (data from MRSA252)
    SA0500(rpoB)DNA-directed RNA polymerase subunit beta  [1] (data from MRSA252)
    SA0501(rpoC)DNA-directed RNA polymerase subunit beta'  [1] (data from MRSA252)
    SA1308(rpsA)30S ribosomal protein S1  [1] (data from MRSA252)
    SA1099(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    SA2041(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    SAS052(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    SA2031(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SA0352(rpsF)30S ribosomal protein S6  [1] (data from MRSA252)
    SA0504(rpsG)30S ribosomal protein S7  [1] (data from MRSA252)
    SA2034(rpsH)30S ribosomal protein S8  [1] (data from MRSA252)
    SA2016(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    SA2048(rpsJ)30S ribosomal protein S10  [1] (data from MRSA252)
    SA2024(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    SA2025(rpsM)30S ribosomal protein S13  [1] (data from MRSA252)
    SA1081(rpsP)30S ribosomal protein S16  [1] (data from MRSA252)
    SA2038(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    SA0354(rpsR)30S ribosomal protein S18  [1] (data from MRSA252)
    SA2043(rpsS)30S ribosomal protein S19  [1] (data from MRSA252)
    SA1414(rpsT)30S ribosomal protein S20  [1] (data from MRSA252)
    SA1871(rsbV)anti-sigmaB factor antagonist  [1] (data from MRSA252)
    SA1870(rsbW)serine-protein kinase RsbW  [1] (data from MRSA252)
    SA0009(serS)seryl-tRNA synthetase  [1] (data from MRSA252)
    SA1382(sodA)superoxide dismutase SodA  [1] (data from MRSA252)
    SA0128(sodM)superoxide dismutase  [1] (data from MRSA252)
    SA0107(spa)immunoglobulin G binding protein A  [1] (data from MRSA252)
    SA0456(spoVG)regulatory protein SpoVG  [1] (data from MRSA252)
    SA1245(sucA)2-oxoglutarate dehydrogenase E1  [1] (data from MRSA252)
    SA1088(sucC)succinyl-CoA synthetase subunit beta  [1] (data from MRSA252)
    SA1089(sucD)succinyl-CoA synthetase subunit alpha  [1] (data from MRSA252)
    SA1506(thrS)threonyl-tRNA synthetase  [1] (data from MRSA252)
    SA1499(tig)trigger factor  [1] (data from MRSA252)
    SA1177(tkt)transketolase  [1] (data from MRSA252)
    SA0729(tpiA)triosephosphate isomerase  [1] (data from MRSA252)
    SA1535(tpx)thiol peroxidase  [1] (data from MRSA252)
    SA1653(TRAP)signal transduction protein TRAP  [1] (data from MRSA252)
    SA0992(trxA)thioredoxin  [1] (data from MRSA252)
    SA0719(trxB)thioredoxine reductase  [1] (data from MRSA252)
    SA1100(tsf)elongation factor Ts  [1] (data from MRSA252)
    SA0506(tuf)elongation factor Tu  [1] (data from MRSA252)
    SA1914(upp)uracil phosphoribosyltransferase  [1] (data from MRSA252)
    SA1488(valS)valyl-tRNA synthetase  [1] (data from MRSA252)
    SA0231hypothetical protein  [1] (data from MRSA252)
    SA0342hypothetical protein  [1] (data from MRSA252)
    SA0370hypothetical protein  [1] (data from MRSA252)
    SA0372hypothetical protein  [1] (data from MRSA252)
    SA0422hypothetical protein  [1] (data from MRSA252)
    SA0437hypothetical protein  [1] (data from MRSA252)
    SA0466hypothetical protein  [1] (data from MRSA252)
    SA0468hypothetical protein  [1] (data from MRSA252)
    SA0477pyridoxal biosynthesis lyase PdxS  [1] (data from MRSA252)
    SA05082-amino-3-ketobutyrate CoA ligase  [1] (data from MRSA252)
    SA0511hypothetical protein  [1] (data from MRSA252)
    SA0528hypothetical protein  [1] (data from MRSA252)
    SA0537phosphomethylpyrimidine kinase  [1] (data from MRSA252)
    SA0544heme peroxidase  [1] (data from MRSA252)
    SA0587hypothetical protein  [1] (data from MRSA252)
    SA0606hypothetical protein  [1] (data from MRSA252)
    SA0618hypothetical protein  [1] (data from MRSA252)
    SA0641hypothetical protein  [1] (data from MRSA252)
    SA0707hypothetical protein  [1] (data from MRSA252)
    SA0758hypothetical protein  [1] (data from MRSA252)
    SA0759hypothetical protein  [1] (data from MRSA252)
    SA0760glycine cleavage system protein H  [1] (data from MRSA252)
    SA0772hypothetical protein  [1] (data from MRSA252)
    SA0774hypothetical protein  [1] (data from MRSA252)
    SA0790hypothetical protein  [1] (data from MRSA252)
    SA0802hypothetical protein  [1] (data from MRSA252)
    SA0815hypothetical protein  [1] (data from MRSA252)
    SA0829hypothetical protein  [1] (data from MRSA252)
    SA0859hypothetical protein  [1] (data from MRSA252)
    SA0873hypothetical protein  [1] (data from MRSA252)
    SA0941hypothetical protein  [1] (data from MRSA252)
    SA1019hypothetical protein  [1] (data from MRSA252)
    SA1069hypothetical protein  [1] (data from MRSA252)
    SA1224hypothetical protein  [1] (data from MRSA252)
    SA1243hypothetical protein  [1] (data from MRSA252)
    SA1252hypothetical protein  [1] (data from MRSA252)
    SA1255PTS system glucose-specific transporter subunit enzyme II A  [1] (data from MRSA252)
    SA1256methionine sulfoxide reductase B  [1] (data from MRSA252)
    SA1272alanine dehydrogenase  [1] (data from MRSA252)
    SA1336glucose-6-phosphate 1-dehydrogenase  [1] (data from MRSA252)
    SA1359elongation factor P  [1] (data from MRSA252)
    SA1360Xaa-Pro dipeptidase  [1] (data from MRSA252)
    SA1365glycine dehydrogenase subunit 2  [1] (data from MRSA252)
    SA1366glycine dehydrogenase subunit 1  [1] (data from MRSA252)
    SA1402hypothetical protein  [1] (data from MRSA252)
    SA1443hypothetical protein  [1] (data from MRSA252)
    SA1501hypothetical protein  [1] (data from MRSA252)
    SA1524hypothetical protein  [1] (data from MRSA252)
    SA1528hypothetical protein  [1] (data from MRSA252)
    SA1532hypothetical protein  [1] (data from MRSA252)
    SA1539septation ring formation regulator EzrA  [1] (data from MRSA252)
    SA1558bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase  [1] (data from MRSA252)
    SA1560hypothetical protein  [1] (data from MRSA252)
    SA1563hypothetical protein  [1] (data from MRSA252)
    SA1565hypothetical protein  [1] (data from MRSA252)
    SA1571D-alanine aminotransferase  [1] (data from MRSA252)
    SA1572dipeptidase PepV  [1] (data from MRSA252)
    SA1573hypothetical protein  [1] (data from MRSA252)
    SA1578hypothetical protein  [1] (data from MRSA252)
    SA1585hypothetical protein  [1] (data from MRSA252)
    SA1599translaldolase  [1] (data from MRSA252)
    SA1671hypothetical protein  [1] (data from MRSA252)
    SA1709hypothetical protein  [1] (data from MRSA252)
    SA1735manganese-dependent inorganic pyrophosphatase  [1] (data from MRSA252)
    SA1737hypothetical protein  [1] (data from MRSA252)
    SA1743hypothetical protein  [1] (data from MRSA252)
    SA1749hypothetical protein  [1] (data from MRSA252)
    SA1924hypothetical protein  [1] (data from MRSA252)
    SA2090hypothetical protein  [1] (data from MRSA252)
    SA2095hypothetical protein  [1] (data from MRSA252)
    SA2098glycerate dehydrogenase  [1] (data from MRSA252)
    SA2202hypothetical protein  [1] (data from MRSA252)
    SA2327pyruvate oxidase  [1] (data from MRSA252)
    SA2395L-lactate dehydrogenase  [1] (data from MRSA252)
    SA2399fructose-1,6-bisphosphate aldolase  [1] (data from MRSA252)
    SAS074hypothetical protein  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.187
    • Ymax_pos: 11
    • Cmax: 0.142
    • Cmax_pos: 46
    • Smax: 0.515
    • Smax_pos: 3
    • Smean: 0.343
    • D: 0.248
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MAQISKYKRVVLKLSGEALAGEKGFGINPVIIKSVAEQVAEVAKMDCEIAVIVGGGNIWRGKTGSDLGMDRGTADYMGMLATVMNALALQDSLEQLDCDTRVLTSIEMKQVAEPYIRRRAIRHLEKKRVVIFAAGIGNPYFSTDTTAALRAAEVEADVILMGKNNVDGVYSADPKVNKDAVKYEHLTHIQMLQEGLQVMDSTASSFCMDNNIPLTVFSIMEEGNIKRAVMGEKIGTLITK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.000 1.001 1.002 1.003 1.004 1.005 1.006 1.007 1.008 1.009 1.010 1.011 1.012 1.013 1.014 1.015 1.016 1.017 1.018 1.019 1.020 1.021 1.022 1.023 1.024 1.025 1.026 1.027 1.028 1.029 1.030 1.031 1.032 1.033 1.034 1.035 1.036 1.037 1.038 1.039 1.040 1.041 1.042 1.043 1.044 1.045 1.046 1.047 1.048 1.049 1.050 1.051 1.052 1.053 1.054 1.055 1.056 1.057 1.058 1.059 1.060 1.061 1.062 1.063 1.064 1.065 1.066 1.067 1.068 1.069 1.070 1.071 1.072 1.073 1.074 1.075 1.076 1.077 1.078 1.079 1.080 1.081 1.082 1.083 1.084 1.085 1.086 1.087 1.088 1.089 1.090 1.091 1.092 1.093 1.094 1.095 1.096 1.097 1.098 1.099 1.100 1.101 1.102 1.103 1.104 1.105 1.106 1.107 1.108 1.109 1.110 1.111 1.112 1.113 1.114 1.115 1.116 1.117 1.118 1.119 1.120 1.121 1.122 1.123 1.124 1.125 1.126 1.127 1.128 1.129 1.130 1.131 1.132 1.133 1.134 1.135 1.136 1.137 1.138 1.139 1.140 1.141 1.142 1.143 1.144 1.145 1.146 1.147 1.148 1.149 1.150 1.151 1.152 1.153 1.154 1.155 1.156 1.157 1.158 1.159 1.160 1.161 1.162 1.163 1.164 1.165 1.166 1.167 1.168 1.169 1.170 1.171 1.172 1.173 1.174 1.175 1.176 1.177 1.178 1.179 1.180 1.181 1.182 1.183 1.184 1.185 1.186 1.187 1.188 1.189 1.190 1.191 1.192 1.193 1.194 1.195 1.196 1.197 1.198 1.199 1.200 1.201 1.202 1.203 1.204 1.205 1.206 1.207 1.208 1.209 1.210 1.211 1.212 1.213 1.214 1.215 1.216 1.217 1.218 1.219 1.220 1.221 1.222 1.223 1.224 1.225 1.226 1.227 1.228 1.229 1.230 1.231 1.232 1.233 1.234 1.235 1.236 1.237 1.238 1.239 1.240 1.241 1.242 1.243 1.244 1.245 1.246 1.247 1.248 1.249 1.250 1.251 1.252 1.253 1.254 1.255 1.256 1.257 1.258 1.259 1.260 1.261 1.262 1.263 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]